ID: 1033786807

View in Genome Browser
Species Human (GRCh38)
Location 7:144741592-144741614
Sequence GTTAAAAATATAACAACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 486}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033786807 Original CRISPR GTTAAAAATATAACAACTGA AGG (reversed) Intronic
901087484 1:6620226-6620248 GTCAAAGAAATAAAAACTGAAGG + Exonic
901751250 1:11410784-11410806 TTTCAAAATATTACCACTGATGG + Intergenic
903341504 1:22657757-22657779 GTTAAAAATATATAGGCTGAGGG + Intronic
904102923 1:28048254-28048276 TTTCAAAATGTAACAGCTGATGG + Intronic
905523545 1:38618783-38618805 TTTAAAAATATAAGAACTACTGG + Intergenic
905848151 1:41251549-41251571 GTCAAAAATATAACAGATGCTGG - Intergenic
905967500 1:42111526-42111548 GGTAAACATTTAACAACAGATGG + Intergenic
905983867 1:42258204-42258226 GTTAAAAAAATAAAAGATGAAGG - Intronic
906007347 1:42487332-42487354 GTTAAAAATATAAGAACTGGGGG + Intronic
907374571 1:54025368-54025390 GTCAAAAAAATAACAAATGCTGG - Intergenic
908446857 1:64206814-64206836 GTTATAAATTTCACAACTGGAGG - Exonic
909594243 1:77387332-77387354 GTTAAAGATACAAAAACTTAGGG + Intronic
910457043 1:87408907-87408929 ATTCAAAATAAAACAACTCAAGG + Intergenic
910626065 1:89308462-89308484 TTTAAAAATCTAATAAATGAAGG - Intergenic
910697099 1:90030960-90030982 GTTAAAAATATATCACCTCCAGG - Intronic
910843181 1:91580827-91580849 TTTAAAAATACAACCACTGTAGG + Intergenic
911885871 1:103298856-103298878 GTAAAGAATAGAACAACTGAAGG + Intergenic
911908462 1:103599638-103599660 GTTGAAATTTTAACACCTGAGGG + Intergenic
911914458 1:103679822-103679844 GTTGAAATTTTAACACCTGAGGG - Intronic
912175691 1:107153516-107153538 GTTAATAATGAAAGAACTGAAGG - Intronic
912336113 1:108864767-108864789 ATTAAAAATAATACAGCTGAGGG + Intronic
913692445 1:121292075-121292097 GCTAAAAATATATCAGGTGAGGG - Intronic
914145112 1:144988027-144988049 GCTAAAAATATATCAGGTGAGGG + Intronic
914350816 1:146838501-146838523 CTGAAAAATATAATAACTTAAGG - Intergenic
915267257 1:154727929-154727951 GTTAAAAATGGAACATCAGATGG + Intronic
915379365 1:155426500-155426522 ATTAAAAATATAAAAATTAATGG - Intronic
917139135 1:171817350-171817372 CTTAAAATTATAAAAGCTGAAGG + Intergenic
917222030 1:172742191-172742213 GGAAAAAATAGAAAAACTGATGG + Intergenic
918171392 1:182001068-182001090 ATTAAAAGTAGAAGAACTGAAGG + Intergenic
918656970 1:187039161-187039183 TTTAAAAAGAAAAGAACTGATGG + Intergenic
919064706 1:192679440-192679462 GTTACAAATCTAAAAAGTGATGG + Intergenic
919264382 1:195242727-195242749 GTAAAAAATATAGTCACTGAAGG - Intergenic
919323222 1:196070148-196070170 ATTAAAAAAACAACAACAGAAGG - Intergenic
920479765 1:206310432-206310454 GCTAAAAATATATCAGGTGAGGG - Intronic
920905743 1:210165884-210165906 CTTAAATATATATTAACTGAAGG - Intronic
921019895 1:211225910-211225932 GTTAAACATTTAAAAACTCAAGG + Intergenic
921141115 1:212307474-212307496 ATTAAAGAAATAACTACTGATGG - Intronic
921870186 1:220131646-220131668 ATTAAAAATATAAAAATTGCTGG - Intronic
923282552 1:232458343-232458365 GATAAAAAGATAACAGCTGCTGG + Intronic
1062787836 10:279956-279978 CTTAAAAATACAAAAACGGAAGG + Intronic
1063642944 10:7849637-7849659 ATTAAAATTATAACAACTATTGG + Intronic
1064079036 10:12293535-12293557 GAAAAAAATATATCAACTGAAGG + Intergenic
1064945968 10:20790313-20790335 GTTATAAAAAAAATAACTGATGG + Intronic
1065624039 10:27612671-27612693 TTTAAAAAGATAACAGTTGATGG + Intergenic
1066258908 10:33709908-33709930 GTTAAAAATATCACATCAAATGG - Intergenic
1066630585 10:37455784-37455806 GGAAAAAATATATCAACTGAAGG + Intergenic
1067429390 10:46233105-46233127 GTTAAAAATATAACAGGTTTAGG - Intergenic
1067576293 10:47410637-47410659 GTTAAAGATATACGAACTGAAGG - Intergenic
1068140768 10:53004201-53004223 GTTAATAAAAGAAAAACTGAAGG - Intergenic
1068534374 10:58224424-58224446 TTTAAAAATATAACATTTGTTGG - Intronic
1068641657 10:59414459-59414481 ATTAAAAATAGAACTACTGGTGG - Intergenic
1068772072 10:60832937-60832959 GTTAAAAATTAAAGAACTGTGGG + Intergenic
1069811755 10:71165775-71165797 GTTAAAAAGATAACAGATGCTGG + Intergenic
1070025968 10:72632333-72632355 GTAAAAAATATAAAATCTGTGGG - Intergenic
1070061097 10:72983801-72983823 GAGAAAAAAAAAACAACTGATGG - Intergenic
1070065859 10:73033759-73033781 GCTAAAATTATAAAAACTGTGGG + Intronic
1070206658 10:74270453-74270475 GTTCAATATATTACAACAGATGG - Intronic
1070664196 10:78332022-78332044 GTTAAAAATCTAAAAACCCAAGG - Intergenic
1071751749 10:88486699-88486721 GTTAAAAAAATAACAGATGCTGG + Intronic
1076556570 10:131326307-131326329 GATAAAAATATCACAACACAGGG + Intergenic
1077041265 11:524793-524815 GTATAAAATATAAAAACTGGTGG + Intergenic
1079581015 11:22064996-22065018 GTAAAAAATATAATAATTAAAGG + Intergenic
1079632410 11:22694169-22694191 GTTAAAAAAATAAGAATTTAGGG + Intronic
1079879809 11:25912332-25912354 GTTAATAATAACACAACTTAAGG + Intergenic
1080355448 11:31439302-31439324 ATTAAAAGTATACAAACTGAAGG - Intronic
1081148779 11:39600358-39600380 ATTAAAAATATAACTACTACAGG + Intergenic
1081163141 11:39776157-39776179 GTGAAAAATATAAAAATGGAAGG + Intergenic
1084345622 11:68546233-68546255 GTTAGAAATACAAGAACTGCTGG + Intronic
1085075923 11:73592129-73592151 GTGAAAAATATATCATCTCAGGG + Intronic
1085330247 11:75643052-75643074 AGTAGAAATATAAAAACTGATGG + Intronic
1086066891 11:82755052-82755074 AATAAAAATATAACAACTCAAGG - Intergenic
1086268626 11:85032265-85032287 GTTTGAAAGAAAACAACTGATGG - Intronic
1086975862 11:93132092-93132114 ATTTAAATTATAAAAACTGAAGG + Intergenic
1087014822 11:93544420-93544442 GGTAAAAATATAACAAGTCTTGG + Intergenic
1087348865 11:97005687-97005709 GGAAAAAATCTAACAACTTAAGG - Intergenic
1088355460 11:108939134-108939156 TTTACAAATAAGACAACTGAGGG + Intronic
1090504263 11:127294242-127294264 GTAAATAATATAACAAATGTTGG + Intergenic
1090967160 11:131609046-131609068 GTTAAAAATAACAAAACTGGGGG + Intronic
1091111700 11:132975262-132975284 GATAAAAGAATAACAAATGATGG + Intronic
1091135855 11:133188700-133188722 GTTAAAAATAGAATAACAAAAGG - Intronic
1093345452 12:18034992-18035014 GTTAAACATTTAACAGCTCAAGG + Intergenic
1093618635 12:21259845-21259867 GTTCAACATATGAAAACTGATGG - Intergenic
1093699842 12:22206970-22206992 TTAAAAAATATAACAAATGATGG + Intronic
1095645405 12:44539767-44539789 GTGTAAAATATAACAATTTATGG - Intronic
1096056820 12:48659753-48659775 TTTAAAAATATATCAGTTGATGG - Intronic
1096929569 12:55191673-55191695 GTTAAAAAAATAACAGTTGCTGG - Intergenic
1096935947 12:55276354-55276376 TTTAAAAAGATAACAAGTGTTGG - Intergenic
1097355223 12:58593654-58593676 CTGAAAAATGTAACATCTGAAGG + Intronic
1097646057 12:62235986-62236008 ATTAAAAAAAAAACAAATGAAGG + Intronic
1097660775 12:62428502-62428524 GTTTATAATATTCCAACTGATGG - Intergenic
1097854267 12:64445422-64445444 GCTAAAAATATAAAAACAGAAGG + Intronic
1097957322 12:65499492-65499514 GTGATAAATACAACCACTGATGG - Intergenic
1098145629 12:67495137-67495159 GTTAAAAAAATAACAGATGCTGG + Intergenic
1098601881 12:72341126-72341148 ATTAAAAAAAAAAAAACTGAAGG - Intronic
1099619405 12:84982230-84982252 GATAAAAATATCACCACTGATGG + Intergenic
1099668119 12:85656705-85656727 GCTAAAACTATGACAACAGAAGG + Intergenic
1100566227 12:95796776-95796798 CTACAAAATATAACAACTTAAGG + Intergenic
1100886872 12:99080638-99080660 TTTGATAATATAACACCTGAAGG - Intronic
1102482619 12:113234092-113234114 TGTAAAAATAGCACAACTGATGG + Intronic
1103120270 12:118374062-118374084 GTTAAAAAGTTAACAATCGAGGG - Intergenic
1104557989 12:129819328-129819350 ATTATAAATATCACAATTGATGG - Intronic
1105831696 13:24168050-24168072 TTTAATAATACAACATCTGAAGG + Intronic
1105956272 13:25286488-25286510 GTTACAAATTTAAAAACGGAAGG - Intronic
1105959663 13:25319639-25319661 GTTAAATATTGAACAACTCATGG + Intronic
1106692412 13:32132500-32132522 GTCAAAAATATAACAATTCTGGG + Intronic
1107056239 13:36107470-36107492 GATAAAAATATAACATCTCTGGG + Intronic
1107873797 13:44771210-44771232 GGTAAATAAATAACATCTGACGG + Intergenic
1108186606 13:47894252-47894274 GATAAAAATATAACAAAACAGGG + Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108707626 13:53004034-53004056 GTTAAAAACAAAACAAATCAGGG - Intergenic
1108914965 13:55597004-55597026 GTTAAAAAAAAAAAAAATGAAGG + Intergenic
1109054968 13:57535315-57535337 ATTAAAAAATTAACAACTCATGG + Intergenic
1109148362 13:58811773-58811795 GTCAAAAAAATAACAAATGTTGG - Intergenic
1109252366 13:60034385-60034407 GTTTAAAAGACAACAACAGAAGG - Intronic
1109464901 13:62717524-62717546 GTGAAAAATTTAACAGCTGAGGG - Intergenic
1109543923 13:63816957-63816979 CTTAAAAATAAATAAACTGATGG - Intergenic
1109672263 13:65624842-65624864 GATAAAAATATAAAAAGTTAAGG - Intergenic
1110043741 13:70800877-70800899 GTTAAAAATAAAACAATAGCTGG + Intergenic
1110062858 13:71064184-71064206 GTTATAAATATACCACTTGAGGG + Intergenic
1110201470 13:72854934-72854956 GTTAAAAGGAAAATAACTGATGG + Intronic
1110413348 13:75226647-75226669 GTTAAAAATATAACCTCTCAAGG + Intergenic
1110434744 13:75466571-75466593 TTTAAAAATATATCATCTGATGG + Intronic
1110513302 13:76379396-76379418 GTTATAGATATGAAAACTGATGG - Intergenic
1111906938 13:94266085-94266107 GGGAAAAGTATAACAACTGCAGG - Intronic
1112833893 13:103489905-103489927 GTAAAAAATGTAACAGCTCAGGG + Intergenic
1113118634 13:106902047-106902069 GTTAAAAACAAAATAATTGAAGG - Intergenic
1113159809 13:107367164-107367186 TTTAAAAAAATAAAAACTGAGGG + Intronic
1114977930 14:28124838-28124860 ATTAAAAATACAAAAAATGAGGG - Intergenic
1115500811 14:34047894-34047916 TTTATAAATATAACAATTGTTGG + Intronic
1115627130 14:35204979-35205001 TTTACAAATGTAAAAACTGAGGG + Intronic
1115886261 14:37975159-37975181 GATAAAAATATAACAGCAGACGG + Intronic
1116060293 14:39915607-39915629 GGTAACAATATAACCACTTAAGG + Intergenic
1116510453 14:45739068-45739090 GATAAAAAAATAACAAATGCTGG - Intergenic
1117030377 14:51663103-51663125 GTTAAAAAAATAACAGATGCTGG + Intronic
1120229403 14:81826763-81826785 GTTAAAAAGATAGAAAGTGAAGG + Intergenic
1120326448 14:83035417-83035439 GTTAAATACATAAAAAATGATGG + Intergenic
1121461125 14:94079411-94079433 AGTAAAAATGTAGCAACTGAAGG - Exonic
1123691493 15:22842037-22842059 GTAAAAAATAAAACATGTGAAGG - Intronic
1124020929 15:25922208-25922230 GTTAAAAAAATAACAGATGCTGG - Intergenic
1125136446 15:36349580-36349602 GAAAAAAATCTAACAATTGAGGG - Intergenic
1125978278 15:43975569-43975591 TTTAAAACTCTAACAACTCAAGG + Intronic
1126413727 15:48396895-48396917 TTTAAAAAAAAAACAACTGTTGG + Intergenic
1126475083 15:49057066-49057088 CTTAAAAATATAACATGAGAAGG + Intergenic
1126497691 15:49310539-49310561 GACAAAAAAATAACAAGTGATGG - Intronic
1128048851 15:64644530-64644552 CTTTAAAATATAACAGATGATGG + Intronic
1128400825 15:67279011-67279033 GTTAAATATATACAAAATGATGG - Intronic
1128472016 15:67962349-67962371 GTTAAAAAAAAAAAAATTGAAGG - Intergenic
1128912351 15:71527414-71527436 GTGAAAAATGTGACAACAGAAGG + Intronic
1129405015 15:75311161-75311183 GTTAAAAAAAAAGCAAATGAGGG - Intergenic
1129491640 15:75932227-75932249 ATTAAAAATATAATAATGGAGGG - Intronic
1129963064 15:79706369-79706391 GATAAAAAAATAACAAAAGATGG - Intergenic
1131947125 15:97635826-97635848 GTTAAAATTAGATCTACTGATGG + Intergenic
1131963476 15:97812838-97812860 GTTAAAAATAGAACAACCATAGG - Intergenic
1132932555 16:2466381-2466403 ATTCAAAATATAAAAACTAAAGG + Intergenic
1133548840 16:6834234-6834256 CTAAAAAATATAAAAACTAATGG - Intronic
1137497054 16:48978555-48978577 TTTAAAAATAGAAGAACTGAGGG + Intergenic
1137646098 16:50076011-50076033 GTTAAAAAAAAAAAAACTTATGG - Intronic
1139983219 16:70877043-70877065 CTGAAAAATATAATAACTTAAGG + Intronic
1140066115 16:71612683-71612705 ATTAAAAATATAACACCTTTTGG - Intergenic
1140102563 16:71930862-71930884 TTTAAAAATATCCCAACAGAGGG + Intronic
1141112282 16:81279943-81279965 ATTAAAAATACAACAGATGATGG - Intronic
1141954735 16:87363086-87363108 GTTAAAAATAAAACAAAAGCCGG + Intronic
1142932111 17:3294228-3294250 AGTAAAAATATAAGAGCTGAGGG + Intergenic
1143842985 17:9749409-9749431 ATAAAAAATATAACAAGTCATGG - Intergenic
1145153606 17:20525579-20525601 GTTAGGAATATAAGTACTGAAGG + Intergenic
1145177019 17:20709277-20709299 GTTAGGAATATAAGTACTGAAGG + Intergenic
1145846874 17:28046656-28046678 GTTAAAGATGTAACAACTTTGGG + Intronic
1145850153 17:28085437-28085459 GTTAAAATTATAAGAGCTGAAGG + Intronic
1146071484 17:29686179-29686201 CTTAAAAATAAAACAACTACAGG + Intronic
1146542607 17:33710693-33710715 TTTACAAATATGAAAACTGAGGG + Intronic
1147033790 17:37664193-37664215 GTGAAAAATATAAAGACTGATGG - Intergenic
1147498363 17:40938812-40938834 GATAAAAATAGAGCAAATGAGGG + Intergenic
1147503902 17:40994408-40994430 GTTGAAAATATAATAACAGAAGG - Intergenic
1147632931 17:41943937-41943959 ATTAAAAATACAAAAACTGTTGG + Intronic
1147871316 17:43589477-43589499 ACTAAAAATATAAAAACTAAAGG + Intergenic
1148230333 17:45928997-45929019 TTTAAAAATATATCCACTGATGG - Intronic
1148248608 17:46053973-46053995 TTTAAAAATATCACAACAGATGG + Intronic
1149216478 17:54360389-54360411 CATAAAAATAAAACAACTGCAGG + Intergenic
1150669318 17:67176888-67176910 CTTAAAAATATTAGCACTGATGG - Intronic
1150947267 17:69761598-69761620 ATGAAAAATATAATAATTGAGGG + Intergenic
1151138055 17:71966561-71966583 TTTAAAAATATCTCCACTGACGG - Intergenic
1151252570 17:72848288-72848310 TTTAAAAATAAATAAACTGAGGG - Intronic
1152153358 17:78616706-78616728 GTTAAAAAAAAAAAAATTGAGGG - Intergenic
1153158691 18:2178673-2178695 GATAAAAATAGAACCACAGAAGG - Intergenic
1155685574 18:28544724-28544746 GGTAAAACTATAACCAGTGAAGG - Intergenic
1155703224 18:28775743-28775765 GATGAAAATATACAAACTGAAGG - Intergenic
1156416078 18:36892120-36892142 GTTAAAAGTCTAACAGATGATGG - Intronic
1156430503 18:37068276-37068298 ATATAAAATATAACAAGTGATGG + Intronic
1156715114 18:39998658-39998680 GTTAAAAACATAACATTTAATGG - Intergenic
1157105444 18:44770421-44770443 GTTAAAAATAAACCAAATAAAGG - Intronic
1157149197 18:45198184-45198206 GTTAAAAATAGAAAAACATAAGG + Intergenic
1157262047 18:46184284-46184306 ATTAAAAATACAAAAACTGCTGG - Intronic
1157850539 18:51045007-51045029 GTGAAAGAGATAACAACAGAGGG + Intronic
1157857028 18:51112637-51112659 GTTAAAAATACAAGGCCTGAAGG + Intergenic
1158780405 18:60642317-60642339 TTTAAAAATGTAAAAATTGAAGG - Intergenic
1159199051 18:65159821-65159843 TTTAAAAATAAAACAAATAATGG + Intergenic
1159434727 18:68401020-68401042 ATCAGAAATATAACAATTGAAGG + Intergenic
1159577515 18:70197927-70197949 GTTAACAATATCACAAATAATGG - Intronic
1159698935 18:71599318-71599340 ATTAAAAATATAAGAGCAGAAGG + Intergenic
1159846589 18:73468427-73468449 GTAAAAAATATTTCAAATGAAGG - Intergenic
1160958067 19:1703855-1703877 TTTTAAAATATAACAACTCCTGG - Intergenic
1161990908 19:7683638-7683660 CTGAAAAATATAATAAATGAGGG - Exonic
1162089588 19:8270281-8270303 GCTAAAAATACAAAAACTGGCGG + Intronic
1163785270 19:19271857-19271879 GTCAAACACATAACAAATGATGG - Intronic
1164429439 19:28174225-28174247 GGTAAAAATATTACATCTCAGGG - Intergenic
1164801392 19:31079754-31079776 GTTTAAAAGTTATCAACTGAGGG - Intergenic
1164943852 19:32273499-32273521 ATTTAAAATATAAACACTGATGG - Intergenic
1166018599 19:40003709-40003731 AGTAAAAATATAACAGCTGTTGG + Intronic
1168367832 19:55804762-55804784 GTTAAAAAAATAACAATTCACGG + Intronic
925674700 2:6349815-6349837 GTTAACAATGGAACAACAGAAGG + Intergenic
926885522 2:17594877-17594899 TTTAAAAATATATCTGCTGAAGG - Intronic
928063787 2:28142274-28142296 GTTTAAAACAAAACAAATGATGG + Intronic
929041773 2:37751392-37751414 GTGAAAATAATAATAACTGAGGG + Intergenic
929247660 2:39720357-39720379 GCTCAAAATATACCACCTGATGG + Intergenic
929323705 2:40579311-40579333 ATTAAGAATAAAATAACTGAAGG - Intronic
929637118 2:43534998-43535020 GACAAAAAAATAACAAATGATGG - Intronic
930347088 2:50197065-50197087 TTTAAAAATATATCAAATGTTGG + Intronic
930362450 2:50399098-50399120 GTGAAAAACATAAAAACAGAGGG - Intronic
930866642 2:56128537-56128559 TTTAAAAAAATACCAAATGATGG + Intergenic
931017817 2:58006073-58006095 GTAAAAAGTATAACCCCTGAGGG + Intronic
931074538 2:58694855-58694877 TTTAAAAATACAAAAATTGAAGG - Intergenic
931077056 2:58727111-58727133 ATAAAAAATAAAAAAACTGAAGG - Intergenic
931519765 2:63082838-63082860 GTTTAAAATATAACCCCTGTAGG + Intergenic
932395343 2:71442418-71442440 TTTAAAATTATAAAAACTGAAGG + Intergenic
932843301 2:75105802-75105824 GTCAAAAAAATTCCAACTGAGGG + Intronic
933380918 2:81544055-81544077 GTTTAAAAGATAACAACAGCAGG - Intergenic
933384419 2:81591766-81591788 GCTTAAACTATAACAAGTGAGGG - Intergenic
933520981 2:83373173-83373195 ATTAAAAAGATAACAAGTGTTGG + Intergenic
933976249 2:87514420-87514442 ATTAAAAAGATATCAACTGAAGG - Intergenic
934603468 2:95676704-95676726 GTTGAAATGAAAACAACTGATGG - Intergenic
934775819 2:96936824-96936846 TTTAAAAAAATAACAACAGGAGG + Intronic
935012679 2:99150159-99150181 GCTAAAGAAATAACGACTGAAGG - Intronic
935041732 2:99436852-99436874 CTTAAAAATATTAGTACTGAGGG + Intronic
935376523 2:102404576-102404598 GATAAAAAAATAACAAATGCTGG - Intergenic
935951059 2:108329182-108329204 GTAAATAATATACCAAATGAAGG + Intergenic
936317573 2:111436386-111436408 ATTAAAAAGATATCAACTGAAGG + Intergenic
936536858 2:113318930-113318952 GTTGAAATAAAAACAACTGATGG - Intergenic
937776206 2:125778887-125778909 TTTATAAATATAAAATCTGAGGG - Intergenic
938011967 2:127835956-127835978 GTTAAAAATTTAACAATAGCTGG + Intergenic
938608919 2:132925857-132925879 GTAAAAAACATAACACCTGGTGG - Intronic
939311895 2:140490398-140490420 CATAAAATTATAACAACTGGTGG - Intronic
939828785 2:147047781-147047803 GTTGGAAATATAAAACCTGAAGG + Intergenic
940157464 2:150674068-150674090 GTTTAGAATTTAACAACAGAAGG + Intergenic
940231592 2:151459636-151459658 TTTAAACATTAAACAACTGAGGG - Intronic
940690702 2:156916141-156916163 TTTAAAAATATAAAAATTAAAGG - Intergenic
941425646 2:165341391-165341413 CTTAAAAATATCACCACTGTGGG - Intronic
941454882 2:165703288-165703310 GTCAAAAAAAGAACAACAGAAGG - Intergenic
941521408 2:166549227-166549249 ATAAGAAATATAAGAACTGAGGG - Intergenic
942777261 2:179597263-179597285 GTTAAAAATATAACCACCAAGGG - Intronic
942782443 2:179661117-179661139 GTTAAAAATAGGAAAACTGAGGG + Intronic
943554589 2:189386813-189386835 GTCAAAAAAATAACAAATGTTGG + Intergenic
943608356 2:190002732-190002754 GGAAAAAATAGACCAACTGACGG - Intronic
943804659 2:192109473-192109495 GTTAAAAATTTAACATCTCTTGG - Intronic
944727141 2:202483027-202483049 TTAAAAAAAATAACAAGTGACGG - Intronic
945525240 2:210880560-210880582 CTTAAAAATAGAACAATTGTTGG - Intergenic
945790305 2:214295873-214295895 ATTAAAAATACATTAACTGAAGG - Intronic
946043313 2:216800958-216800980 GCTAAAAATATAACGAAAGAAGG - Intergenic
946113481 2:217440691-217440713 ACTAAAAATATAAAAACTCATGG - Intronic
947196176 2:227569929-227569951 CTTAAAAATTCCACAACTGAGGG - Intergenic
947408126 2:229802634-229802656 GAAAAAAATATAAAAACTAAAGG + Intronic
947508249 2:230726669-230726691 TTTAACAATATAAAAACAGAAGG - Intronic
947974223 2:234350767-234350789 GTTAATAATATAAGAATTTAAGG + Intergenic
1169460232 20:5788202-5788224 CTTAAAAATAATACAATTGAGGG + Intronic
1170376166 20:15702318-15702340 CTTAAAAAAATAACAAGTGCTGG - Intronic
1170718195 20:18850427-18850449 GTTAAAAATATATTTACTGATGG - Intergenic
1171960340 20:31488988-31489010 GTTAAAAATAATACGAATGATGG + Intergenic
1172099587 20:32477153-32477175 GTTCAAACCATAACAACAGAAGG + Intronic
1172346687 20:34207156-34207178 TTTAAAAAAATAACAAATGCTGG - Intronic
1173355559 20:42284840-42284862 GTTAAAAAAATGACAAGTCATGG + Intronic
1174311543 20:49659572-49659594 GCTAAAAAAATAAAAACTGAGGG + Intronic
1174460524 20:50679231-50679253 TTTAAAAATATATAAAATGAGGG + Intronic
1174735352 20:52960768-52960790 GTTAAGAATAAAACAACTGGAGG + Intergenic
1175427088 20:58875073-58875095 GTTAAAAATAAGACAAGGGAAGG + Intronic
1176553264 21:8239696-8239718 TTTAAAAAAATAACAACACAAGG + Intergenic
1176572186 21:8422720-8422742 TTTAAAAAAATAACAACACAAGG + Intergenic
1176580095 21:8467280-8467302 TTTAAAAAAATAACAACACAAGG + Intergenic
1177041475 21:16116716-16116738 GTTAAAAAAAAAAAGACTGAGGG - Intergenic
1177335140 21:19714938-19714960 ATTAAAAATATAGCAATTGCTGG + Intergenic
1178899111 21:36584660-36584682 GCTAAAAATATACCAACCCAAGG + Intergenic
1179135953 21:38679828-38679850 GTTAAAAATAGCTCAACTGTGGG - Intergenic
1180888381 22:19265554-19265576 GATAAAAATAGCACAACAGAGGG + Intronic
1184162639 22:42706496-42706518 GTTAAAAATATAAGAACAGCCGG + Intronic
1184226057 22:43129368-43129390 GTTAAAAAGATAACAGCAGCAGG - Exonic
1203258262 22_KI270733v1_random:156724-156746 TTTAAAAAAATAACAACACAAGG + Intergenic
1203293995 22_KI270736v1_random:22912-22934 GTGAAAATAATAATAACTGAGGG + Intergenic
951021684 3:17787817-17787839 GTAAAAAAAATAACAAATGCTGG - Intronic
951228001 3:20143370-20143392 GTTAAAAAAATAACAGATGTTGG + Intronic
951365249 3:21773759-21773781 GTCAAAAAAAAAACAACTGCTGG + Intronic
952544221 3:34401168-34401190 GTTAAAAAAATAACAGATGCTGG + Intergenic
953360055 3:42288073-42288095 TTTAAATATATAACAATTGGAGG - Intergenic
953842327 3:46398972-46398994 TTTAAAACTATAACATCTGCTGG - Intergenic
953948107 3:47165736-47165758 TTTAAAAAGTTAACCACTGAAGG - Intergenic
954725434 3:52604799-52604821 GCTGAAAATACAAAAACTGATGG + Intronic
955033063 3:55239699-55239721 GTCAAAAAAATAACAAATGTTGG + Intergenic
957560886 3:81819329-81819351 GTTATAAAAATAAAAACTCATGG + Intergenic
958040908 3:88225121-88225143 ATCTAAAATATAACAACTGCTGG - Intergenic
958938427 3:100283571-100283593 GTTAAAAATAAAGTTACTGAGGG - Intronic
959250959 3:103944947-103944969 GTTAAGAATATAAAGATTGATGG - Intergenic
959917579 3:111835190-111835212 CATAAAAATATAGAAACTGATGG + Intronic
960475790 3:118126179-118126201 AATAAAAATATAACATCTGTTGG - Intergenic
961078856 3:124007170-124007192 GTTAAAAAAATAATTATTGAAGG + Intergenic
961569002 3:127785019-127785041 GTTAAATGTTTAACAACTGGGGG + Intronic
963944524 3:151130832-151130854 ATAAAAAATATAACATCAGATGG - Intronic
964211399 3:154232339-154232361 GTTAATAATATAACAAATAGTGG - Intronic
964956615 3:162366473-162366495 GTAAAAGCAATAACAACTGAGGG + Intergenic
965234252 3:166094678-166094700 ATTAAAAAAATAAGAAGTGAGGG + Intergenic
965267451 3:166562253-166562275 GTTAAAAATAAAGAAACCGAAGG + Intergenic
965563276 3:170082302-170082324 GCTTAAAATTTAACAAATGAAGG + Intronic
967473921 3:189893687-189893709 TTTATAGATAGAACAACTGAAGG - Intronic
968293628 3:197556739-197556761 TTTAATAATAGAACAACGGAGGG + Intronic
969564087 4:7967453-7967475 GTAACAAATATGACCACTGAAGG - Intronic
970841170 4:20471305-20471327 GTAAAATATATTATAACTGAGGG + Intronic
971506397 4:27370647-27370669 TTTAAAAACATAACACATGAAGG + Intergenic
972361580 4:38330598-38330620 GTCAAGAAGATAACAACTGCAGG + Intergenic
974340213 4:60604600-60604622 TTTAAAAAAATAGAAACTGAAGG - Intergenic
974368214 4:60980719-60980741 GGTAAAAATAAAACAACTTTGGG - Intergenic
975915205 4:79317012-79317034 GTTAAATATGTAACTAATGAAGG + Exonic
975962688 4:79932490-79932512 GTTAAAAATTTAGCATGTGATGG + Intronic
976748173 4:88426854-88426876 GTTACAAAAATAAAAACAGATGG - Intronic
977801218 4:101234636-101234658 GATAAAAAAATAAAAATTGATGG - Intronic
978045513 4:104121522-104121544 GATAAAAATATAATAACTGCTGG + Intergenic
978072162 4:104487490-104487512 GTTGTGAATATAAAAACTGAAGG + Intronic
979614133 4:122722630-122722652 GTTAAAAATATAAAAATTTTAGG - Intergenic
980453307 4:133005739-133005761 TTTAAAAGTATAACAACAGATGG + Intergenic
980928479 4:139162215-139162237 ATTAAAAAAATAACAAATTATGG + Intronic
981090189 4:140724116-140724138 GTCATAAAAATAACAAATGATGG + Intronic
981125028 4:141095799-141095821 GAGAAAAATATAATCACTGAGGG + Intronic
981253677 4:142635196-142635218 GTTAAAAAAATAACAGATGCTGG + Intronic
981302886 4:143209849-143209871 GAGAAAAATATAAAAACTTAGGG - Intronic
981399568 4:144297782-144297804 GTTAAAACTATAAAACCTGTAGG - Intergenic
982047538 4:151463854-151463876 GTAAAAAATAGAAAAACTCAGGG - Intronic
982378663 4:154724200-154724222 GTTTAAAATATCACAAGTAAAGG + Intronic
982635443 4:157890176-157890198 GTTAAAAATAAAACAAGGAAGGG - Intergenic
982898512 4:160966341-160966363 GTCAAAAAAATAACAAGTGTTGG - Intergenic
983033575 4:162834586-162834608 GTTACAAATTTAACAACTCAAGG + Intergenic
983569488 4:169189598-169189620 GTTAAAAATAAAACCAGTGGTGG + Intronic
984144184 4:176041213-176041235 ATTAAAAAAATAACAACTCCTGG + Intergenic
984409933 4:179384474-179384496 GTTCCAAATTAAACAACTGAAGG - Intergenic
985857378 5:2440422-2440444 GGTTTGAATATAACAACTGAAGG - Intergenic
986204030 5:5606419-5606441 GTTAAAAGTATAATAAATCAAGG + Intergenic
987806909 5:22781096-22781118 TTTAAAAATGTAACAACTCAAGG - Intronic
988129562 5:27085422-27085444 GATAAAAAGATAAAAACTAACGG + Intronic
988333286 5:29871684-29871706 GTTCAAAAAATAACAAATGCTGG - Intergenic
988683618 5:33506419-33506441 TTTAAAAATAACACAAGTGAAGG - Intergenic
989214412 5:38889357-38889379 GTTTAAAATAAAATAAATGAAGG - Intronic
989269783 5:39519100-39519122 GATAAAGAGATACCAACTGAGGG - Intergenic
989671323 5:43919993-43920015 ATGAAAACTATAAAAACTGATGG - Intergenic
989781593 5:45271929-45271951 GTGAGAAAAAGAACAACTGAAGG + Intronic
990213517 5:53506088-53506110 GTTAAAAATAAGCCAACTGCTGG - Intergenic
990245040 5:53856205-53856227 GTAAAAAATGTAACTACTGTGGG + Intergenic
990285005 5:54292338-54292360 TATAAAAATCTAACAACTAAAGG + Intronic
990297188 5:54414272-54414294 GATGAAAAAATAATAACTGAAGG + Intergenic
990386583 5:55269911-55269933 GTCAAAAATCTAAGAACTGAAGG + Intronic
990826620 5:59907168-59907190 GTCAAAAAAATAACAGCTGCTGG - Intronic
991370148 5:65909915-65909937 GTTAAAAGTATTACTACGGATGG - Intergenic
991424842 5:66479974-66479996 GTTAAAAAAAAAAAAAATGAGGG - Intergenic
992882567 5:81125047-81125069 ACTAAAAATATAAAAACTGCTGG - Intronic
993629851 5:90272662-90272684 TTTAAAAATACCACTACTGAAGG + Intergenic
993906128 5:93625011-93625033 GAAAAAAATATCATAACTGATGG + Intronic
993973524 5:94448996-94449018 GTTGAAAATATGACACCTAATGG + Intronic
994031670 5:95150122-95150144 TTTAAAAATATAAAAACAAATGG - Intronic
994174677 5:96698518-96698540 GTAAAAAATATGAGAACGGAAGG - Intronic
994279208 5:97881022-97881044 CTAGAAAATATATCAACTGAAGG + Intergenic
994505153 5:100633754-100633776 TTTAAAAATATAACAAGGTAGGG - Intergenic
994630658 5:102282503-102282525 ATAAAAAATATAACAAAGGAGGG + Intronic
994939253 5:106299846-106299868 GTCAAAATTGTAACAAATGATGG - Intergenic
995973930 5:118008023-118008045 GTTAAAAAAATAAAAACAGAAGG - Intergenic
996649167 5:125852570-125852592 GTTAAGAATAGAAAAACAGAAGG - Intergenic
997002899 5:129783797-129783819 ATTAAAAATATAACACCAGAGGG + Intergenic
997752576 5:136361415-136361437 TTGATAAAAATAACAACTGAAGG - Intronic
999026567 5:148239438-148239460 GTTACAAATATAAGAAGTGGGGG - Intergenic
1000085408 5:157883732-157883754 GTTAAACATTTAAAAACTCAAGG + Intergenic
1000600086 5:163262439-163262461 GGTAATAATATAACAATTGCAGG - Intergenic
1001155798 5:169271624-169271646 ATTAAAAAGAAAACAACTGCGGG + Intronic
1003439827 6:6129761-6129783 GTTAAAACCATTAGAACTGATGG - Intergenic
1003524421 6:6886076-6886098 GTTTAAAATATATCAACCGAAGG + Intergenic
1003529570 6:6926788-6926810 ATTAAAAATGTATCAAATGAGGG + Intergenic
1003814635 6:9824931-9824953 TTTACAAATAACACAACTGAGGG + Intronic
1004586666 6:17008922-17008944 GACAAAAAAATAACAAATGATGG + Intergenic
1004598349 6:17123206-17123228 TTTAAAAAAATAATAACTGTGGG + Intronic
1005517790 6:26571102-26571124 GTTACAATTGTAACAACTTAAGG + Intergenic
1005670752 6:28104277-28104299 CTTAAAAAAAAAAAAACTGATGG + Intergenic
1005719018 6:28582619-28582641 ATTAAAACTATAACAACTCCCGG + Intronic
1007083649 6:39127335-39127357 ATTAAAAAAAAAACAACTGATGG + Intergenic
1007288622 6:40766881-40766903 GTAAAAAAAATAACAAATGCTGG - Intergenic
1008439107 6:51511944-51511966 GATAAAAATGTAAAAAATGAAGG + Intergenic
1008975760 6:57424420-57424442 GTTAATTATATAAGAACAGATGG + Intronic
1009540487 6:64950234-64950256 TTTAAAAATATACCAAAGGAGGG + Intronic
1009759179 6:67981139-67981161 CTTCAAAAAATAAGAACTGAGGG - Intergenic
1010371166 6:75109067-75109089 GCTGGAAATATAACAACTGATGG - Exonic
1010748378 6:79590139-79590161 GTCAAAAAAATAACAAATGCTGG + Intergenic
1011671775 6:89690407-89690429 GTAAAAAATATAAAAACGGCAGG + Intronic
1011880019 6:92012521-92012543 GTTAAAAATGTGAAAAATGATGG + Intergenic
1012050456 6:94335826-94335848 GATAAATATATAACAATTTATGG + Intergenic
1012946349 6:105469987-105470009 GTGAAACAGATAAAAACTGAGGG + Intergenic
1012991856 6:105934363-105934385 GTCAAAAAAATAACAAATGCTGG - Intergenic
1013141909 6:107345546-107345568 GTAAAAAATACAACAGCAGATGG + Intronic
1013759241 6:113497615-113497637 GTGACAAATATAACATCTTACGG + Intergenic
1014288125 6:119526559-119526581 ATTAAAATTAAAGCAACTGATGG + Intergenic
1014458958 6:121672293-121672315 TTTAAAGATATAACAACAAAGGG + Intergenic
1014691435 6:124568314-124568336 CTTACAAATTTAACAAATGAAGG + Intronic
1014737772 6:125113873-125113895 ATTAAATACATAACATCTGAGGG - Intergenic
1014869893 6:126581052-126581074 GTTATAAATAAAACAATTTATGG + Intergenic
1015181163 6:130364626-130364648 GGTAAAAATAAAACCACAGATGG + Intronic
1015482337 6:133726551-133726573 GCTAAAGATACAATAACTGAAGG - Intergenic
1015725045 6:136291099-136291121 TTTAAAAAAAAAACAACTAAGGG + Intergenic
1016157847 6:140835244-140835266 GTGAATAATATAGCAAATGATGG + Intergenic
1016899237 6:149084644-149084666 GTTAAAAAGTAAACAAATGAGGG + Intergenic
1017161574 6:151370555-151370577 ATCAAAAATAAAACCACTGAGGG - Intronic
1017167339 6:151421815-151421837 ATTAAAAATACTGCAACTGACGG + Intronic
1017809534 6:157974876-157974898 GTGAAAAATGAAACAAGTGAGGG - Intergenic
1018435029 6:163751752-163751774 TTTAAAAATACAACTACTGTTGG + Intergenic
1018657551 6:166054040-166054062 GTGCAAAATATAAGAAATGATGG - Intergenic
1018730056 6:166642755-166642777 GTAAAAAAAATACCAACTGTTGG + Intronic
1019275781 7:174837-174859 GTTAAAAATAGAAATAATGAAGG + Intergenic
1019971567 7:4545432-4545454 ATTAAAAATACAACAATTGTAGG - Intergenic
1020337612 7:7074226-7074248 ATTACAAATATAACCACAGAGGG - Intergenic
1020631215 7:10642367-10642389 GTTTAAAATATGAAAAATGAAGG - Intergenic
1020643843 7:10789548-10789570 CTTAAAAATATAAACACTCATGG + Intergenic
1020859300 7:13469894-13469916 GTTTAAAATATAACAATGTATGG - Intergenic
1021196285 7:17678125-17678147 GGGAAAAATAAAACAACTGAAGG + Intergenic
1021534763 7:21690799-21690821 GTAATAAATATTCCAACTGATGG - Exonic
1023083378 7:36546392-36546414 GTTAAAAAAATAAAGACAGATGG - Intronic
1023366324 7:39466971-39466993 GTTAACAAGATAACATATGATGG + Intronic
1023459620 7:40381029-40381051 ATTAAAAATATGACAAATGATGG - Intronic
1024162053 7:46686863-46686885 ATTAAAAATAGAACTACTGCAGG + Intronic
1024488801 7:49952846-49952868 GTTAAAAAAAGAAAAACTAAAGG + Intronic
1024921564 7:54562220-54562242 TTTATAAATATAAAAACTAAAGG - Intronic
1026376148 7:69753088-69753110 TTTATAATTATAAAAACTGAGGG - Intronic
1026412963 7:70144769-70144791 CTTTCAACTATAACAACTGAAGG - Intronic
1026645276 7:72162243-72162265 ATTAAATATATAACAATTGTTGG + Intronic
1027409432 7:77899241-77899263 GTGAAAAACATAACAAATAAAGG + Intronic
1027487649 7:78781911-78781933 TTAAGAAATATAACAATTGAAGG - Intronic
1027576547 7:79937531-79937553 GTTAAAAAACTAAAAACTAATGG - Intergenic
1027712268 7:81619639-81619661 TTTAAAAATAAGACAAGTGAGGG - Intergenic
1027804679 7:82802478-82802500 GTTAATAATTTAACAGCTAAAGG + Intronic
1028110907 7:86940009-86940031 GTAAAAAATATCACAATTGAAGG - Exonic
1028604236 7:92638058-92638080 GCTAAAATTATACCATCTGAAGG - Intronic
1029107528 7:98190672-98190694 GTTAAAAATTTGACATCTAAAGG + Intronic
1029798144 7:102916948-102916970 GTTAAATTTCTAACACCTGAAGG + Intronic
1030870658 7:114751741-114751763 GGTAAAAATACAATAACTGTTGG + Intergenic
1030919583 7:115365399-115365421 ATTAAAAATATAAGATGTGAGGG + Intergenic
1030942423 7:115670590-115670612 GTTACAAATATAAAAACATAAGG + Intergenic
1031274155 7:119696795-119696817 TTTTAAAATATACCACCTGAAGG - Intergenic
1031376337 7:121031271-121031293 GGTAAAAATATTAAAACTGTGGG + Intronic
1031456733 7:121990096-121990118 GCAAAAAATATATGAACTGAAGG - Intronic
1032061443 7:128728511-128728533 GTTATAAGTAAAACAACTGCTGG + Intronic
1033488317 7:141813972-141813994 CTCAAAACTTTAACAACTGAGGG - Intergenic
1033786807 7:144741592-144741614 GTTAAAAATATAACAACTGAAGG - Intronic
1034462795 7:151207439-151207461 ATTCAAGATATAAAAACTGAAGG - Intergenic
1035244110 7:157551323-157551345 GTGAAAAATACCACAACTGTAGG + Intronic
1036720767 8:11173033-11173055 GTTAAAAATATAACAGCTTCCGG + Intronic
1036837309 8:12084172-12084194 GATAGACATATAACAAGTGACGG + Intergenic
1036859102 8:12330416-12330438 GATAGACATATAACAAGTGACGG + Intergenic
1037080476 8:14779239-14779261 ATTAAAAATATCACAACTTTTGG + Intronic
1037188223 8:16090539-16090561 GATAAAAATATTAAAACTAAGGG - Intergenic
1037431532 8:18818321-18818343 CTTTAAAATATAATAAATGAAGG - Intronic
1037966383 8:23136963-23136985 ACTAAAAATATAACTAGTGACGG - Exonic
1038270551 8:26071805-26071827 GTTAAATAAATACCAAATGATGG - Intergenic
1038430100 8:27493144-27493166 GTTAAAAATACAGGGACTGAAGG + Intronic
1039311008 8:36317772-36317794 GGTAAAAATATAACAGATGTTGG + Intergenic
1039530350 8:38255982-38256004 TTTAAAAATATTAAAACTGTTGG - Intronic
1040443451 8:47469181-47469203 GTCAAAAAAATAACAGCTGCTGG + Intronic
1040649127 8:49430041-49430063 GTTAAACATTTAAAAACTCAAGG + Intergenic
1041187627 8:55317352-55317374 GTTAGAAAAATAACAACCAATGG - Intronic
1041697813 8:60755616-60755638 AGTAAACATATTACAACTGATGG - Intronic
1041725521 8:61013804-61013826 TTTAAAAGTAACACAACTGATGG - Intergenic
1042460248 8:69057511-69057533 GGTAAAAATATAAGTACAGATGG + Intergenic
1042665877 8:71205417-71205439 GGTAAAAAAAGAACAACTGGTGG + Intronic
1043381149 8:79703538-79703560 GTTAAAAATACAGCAACTGGAGG + Intergenic
1043530345 8:81143104-81143126 GCTAAGAATATAACCACTGTAGG + Intergenic
1044127785 8:88479678-88479700 GTAAAAAATATAACAGTTGCTGG + Intergenic
1044155058 8:88836072-88836094 TTTAACAATACATCAACTGATGG - Intergenic
1044232163 8:89791242-89791264 GTTAAGAAAATAAAAACTGTGGG - Intergenic
1044425781 8:92048379-92048401 CCTAAAAATATTACAACTGGCGG + Intronic
1045127629 8:99110384-99110406 AATAAAAATAAAACAATTGATGG - Intronic
1046180785 8:110644650-110644672 GTTAAATCTATAATAACTGGAGG - Intergenic
1046373338 8:113341622-113341644 GTTTAAAATATGGAAACTGAGGG + Intronic
1047133541 8:122050487-122050509 GTTATAAGTATAAAAATTGAGGG - Intergenic
1047948102 8:129902775-129902797 GTTATAATTAAAACAACTGCAGG + Intronic
1048246971 8:132815731-132815753 GTAGAAAATATGGCAACTGAAGG - Intronic
1048688817 8:136935242-136935264 ATTAAAAATTTAAAAAGTGAGGG - Intergenic
1048935633 8:139353871-139353893 GTAAAAATTATAACAAGGGATGG + Intergenic
1050789361 9:9447003-9447025 GTCAATAATATAACAAGTGCTGG + Intronic
1051289249 9:15528655-15528677 GTTCAAAACCTAAAAACTGAAGG - Intergenic
1051655950 9:19381688-19381710 ATTAAAAAAATAACAAGTGTTGG - Intergenic
1052520546 9:29542917-29542939 GTTAATAATAGGAGAACTGAGGG - Intergenic
1052631382 9:31045586-31045608 GTAAAAAATATATCAAGTCATGG - Intergenic
1053509412 9:38674975-38674997 CCTGAAAATATAACCACTGATGG + Intergenic
1054742204 9:68818339-68818361 GTTAAAATTAAAACAAAGGAAGG - Intronic
1055162300 9:73145018-73145040 GGTAAAAATATAACATAAGAAGG - Intergenic
1055796138 9:79976801-79976823 CTTGAAAATAGAGCAACTGAAGG + Intergenic
1056099750 9:83289949-83289971 TTTAAAAATATAACAAATGTGGG + Intronic
1057023100 9:91715929-91715951 CTTAAAAAGATAACAAATGCCGG + Intronic
1057944745 9:99315775-99315797 ATTAAATATTTAACTACTGAGGG + Intergenic
1059085304 9:111295244-111295266 TTTACAAATATAACACATGATGG + Intergenic
1059310294 9:113384165-113384187 ATTAAAAATAAAACTAGTGAAGG - Intergenic
1059513015 9:114866637-114866659 GTCACAAATATAACAAATGTTGG - Intergenic
1061344640 9:130013133-130013155 ATAAAAAATAGAACAATTGAAGG - Intronic
1061419944 9:130467627-130467649 CTTAATAATAAAACAACAGATGG - Intronic
1203474456 Un_GL000220v1:138740-138762 TTTAAAAAAATAACAACACAAGG + Intergenic
1185783596 X:2870094-2870116 CTTAAAAAAAAAAAAACTGAAGG - Intronic
1186358998 X:8819361-8819383 GTTTAAGATATAACACCAGATGG + Intergenic
1186491041 X:9972381-9972403 CTTAAAAAAAAAAAAACTGATGG - Intergenic
1186636544 X:11411650-11411672 GTTCAAAATCTAATAAATGAGGG - Intronic
1186869747 X:13759248-13759270 GATAAAAATAAAACAAGTGCTGG - Intronic
1188027422 X:25224936-25224958 GTGAGAAATATAATAACTAAAGG - Intergenic
1188093492 X:25992365-25992387 GTGAAAAATGAAACAACTTATGG + Intergenic
1188220235 X:27532509-27532531 GTTATAAATATAAGAGATGATGG + Intergenic
1193076314 X:77359740-77359762 GTTAAAGGTAGAACATCTGAAGG + Intergenic
1193106598 X:77682131-77682153 ATTAAGAATGGAACAACTGATGG - Exonic
1193189823 X:78557342-78557364 GTTAAAAAGATCACAAGTTAAGG - Intergenic
1193208610 X:78779041-78779063 TTTAAAAATACAAGAAATGAGGG - Intergenic
1193272816 X:79548681-79548703 GTTAAAAATATTCCAAATGATGG + Intergenic
1193357518 X:80538672-80538694 GTTCAAAAAATAACAGATGATGG + Intergenic
1193675339 X:84445348-84445370 GCTAATACTAAAACAACTGATGG - Intronic
1193961642 X:87932829-87932851 GTTAAAAATAAAATTGCTGAGGG - Intergenic
1193995206 X:88358246-88358268 GTTAAAAAAATTAAAAATGAAGG + Intergenic
1194619403 X:96150771-96150793 GATGAAAATATATCAAGTGAAGG + Intergenic
1196698455 X:118639627-118639649 GTTTAAATAATAAAAACTGAAGG + Intronic
1196999826 X:121426742-121426764 GGTTAAACTATAACACCTGAAGG + Intergenic
1197053347 X:122087962-122087984 ATTAAAACTGTAACAACTGGGGG - Intergenic
1197094833 X:122581478-122581500 GTTAAAAAAATAACAGATGCTGG + Intergenic
1197597526 X:128483992-128484014 GTCAAAAAAATAACAAATGTTGG - Intergenic
1199044797 X:143156456-143156478 AATAAAAATAGAAAAACTGAAGG + Intergenic
1199050383 X:143230135-143230157 GTAAGAAATATAACAAGTGTTGG - Intergenic
1199273838 X:145919518-145919540 GTTAAAAATAGAACTACCAAAGG + Intergenic
1199299479 X:146196219-146196241 GAAAAAAATATAATAACAGAAGG - Intergenic
1199384343 X:147206598-147206620 ATTAAAAATATGACAAAGGATGG - Intergenic
1200694606 Y:6347765-6347787 GTTAAAAATACAGGACCTGAAGG + Intergenic
1201040671 Y:9826945-9826967 GTTAAAAATACAGGACCTGAAGG - Intergenic
1201271684 Y:12261737-12261759 GTTAAAAATACAAGGCCTGAAGG + Intergenic
1201608566 Y:15815252-15815274 TTTGAAAATATAATAACTGTTGG - Intergenic
1201987189 Y:19982014-19982036 GTTAAAAAAAAAAAAACTTAAGG - Intergenic