ID: 1033789937

View in Genome Browser
Species Human (GRCh38)
Location 7:144779331-144779353
Sequence ATACACACACACAATTATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2635
Summary {0: 1, 1: 0, 2: 32, 3: 363, 4: 2239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033789937_1033789938 27 Left 1033789937 7:144779331-144779353 CCTATATAATTGTGTGTGTGTAT 0: 1
1: 0
2: 32
3: 363
4: 2239
Right 1033789938 7:144779381-144779403 TGCTAACAAAGAGTATTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033789937 Original CRISPR ATACACACACACAATTATAT AGG (reversed) Intronic
Too many off-targets to display for this crispr