ID: 1033791387

View in Genome Browser
Species Human (GRCh38)
Location 7:144795972-144795994
Sequence CTCTCAGCCCTGAGAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 274}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033791377_1033791387 19 Left 1033791377 7:144795930-144795952 CCAGCAGTAAGCCACAGCTGCAC 0: 1
1: 0
2: 1
3: 17
4: 185
Right 1033791387 7:144795972-144795994 CTCTCAGCCCTGAGAGTGGGTGG 0: 1
1: 0
2: 4
3: 21
4: 274
1033791374_1033791387 22 Left 1033791374 7:144795927-144795949 CCCCCAGCAGTAAGCCACAGCTG 0: 1
1: 0
2: 1
3: 11
4: 189
Right 1033791387 7:144795972-144795994 CTCTCAGCCCTGAGAGTGGGTGG 0: 1
1: 0
2: 4
3: 21
4: 274
1033791375_1033791387 21 Left 1033791375 7:144795928-144795950 CCCCAGCAGTAAGCCACAGCTGC 0: 1
1: 0
2: 0
3: 18
4: 223
Right 1033791387 7:144795972-144795994 CTCTCAGCCCTGAGAGTGGGTGG 0: 1
1: 0
2: 4
3: 21
4: 274
1033791373_1033791387 29 Left 1033791373 7:144795920-144795942 CCAACTACCCCCAGCAGTAAGCC 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1033791387 7:144795972-144795994 CTCTCAGCCCTGAGAGTGGGTGG 0: 1
1: 0
2: 4
3: 21
4: 274
1033791376_1033791387 20 Left 1033791376 7:144795929-144795951 CCCAGCAGTAAGCCACAGCTGCA 0: 1
1: 0
2: 1
3: 18
4: 172
Right 1033791387 7:144795972-144795994 CTCTCAGCCCTGAGAGTGGGTGG 0: 1
1: 0
2: 4
3: 21
4: 274
1033791382_1033791387 -9 Left 1033791382 7:144795958-144795980 CCACCCAGGCTAGGCTCTCAGCC 0: 1
1: 0
2: 2
3: 24
4: 310
Right 1033791387 7:144795972-144795994 CTCTCAGCCCTGAGAGTGGGTGG 0: 1
1: 0
2: 4
3: 21
4: 274
1033791378_1033791387 8 Left 1033791378 7:144795941-144795963 CCACAGCTGCACAGCCTCCACCC 0: 1
1: 0
2: 11
3: 96
4: 630
Right 1033791387 7:144795972-144795994 CTCTCAGCCCTGAGAGTGGGTGG 0: 1
1: 0
2: 4
3: 21
4: 274
1033791381_1033791387 -6 Left 1033791381 7:144795955-144795977 CCTCCACCCAGGCTAGGCTCTCA 0: 1
1: 0
2: 3
3: 19
4: 249
Right 1033791387 7:144795972-144795994 CTCTCAGCCCTGAGAGTGGGTGG 0: 1
1: 0
2: 4
3: 21
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033791387 Original CRISPR CTCTCAGCCCTGAGAGTGGG TGG Intronic
900998794 1:6137056-6137078 AACACAGCCCTGAGAGAGGGTGG + Intronic
901430786 1:9213358-9213380 CTCTCAGCCCCGGGAGTAGTTGG + Intergenic
901678165 1:10898725-10898747 CTCTCAGCCCTGGGCCTGGTTGG - Intergenic
901916951 1:12507222-12507244 CTCTCAGTCCTGAACATGGGAGG + Intronic
902221159 1:14966784-14966806 GTCTCAGCCCTGCGAGTAGCTGG + Intronic
902893316 1:19460997-19461019 TTCCCAGCCTTGAGAGAGGGAGG - Intronic
907238172 1:53065457-53065479 CTCACAGCCCTGAGAGTGGCTGG + Intronic
907455524 1:54572909-54572931 TTCTCAGCTCTCAGAGTGGGAGG - Intronic
907639349 1:56170597-56170619 CTCAAAGACCTGAGAGTTGGGGG + Intergenic
913345254 1:117802803-117802825 CTTGCAGCCCTGAGTGTGGGTGG - Intergenic
915338981 1:155166166-155166188 CTTTCAGCCCTGGGGGTGGGAGG + Intergenic
916132257 1:161621522-161621544 CTCACAGCCCTGAGCGAGGCAGG - Intronic
917284888 1:173413454-173413476 TTTTCAGCACTGAGAGTGGGAGG - Intergenic
922182115 1:223243495-223243517 TTCACAGCACTGAGGGTGGGTGG + Intronic
922551473 1:226497608-226497630 TTCTCTGCCCAGGGAGTGGGAGG + Intergenic
922594956 1:226806504-226806526 CTGTCAGCCCTGGGAGTCTGTGG - Intergenic
922882226 1:228989706-228989728 CTCTCAGCTCTGGTAGGGGGTGG + Intergenic
1063914728 10:10869864-10869886 CTCTCAGCCTTCAGAGTAGCTGG - Intergenic
1068675228 10:59763427-59763449 ATCTCAGCCCTCTGAGTGGCTGG + Intergenic
1068864708 10:61882839-61882861 ATGTCTGCCATGAGAGTGGGCGG - Intergenic
1069540862 10:69292913-69292935 CTAGCAGCCCTGAGATTGGTTGG + Intronic
1070820918 10:79353775-79353797 CTTTCGGCTCTAAGAGTGGGAGG + Exonic
1071301469 10:84258835-84258857 CTCTCAGCCTTGAGTGTAGGGGG - Exonic
1071501320 10:86206287-86206309 CTGGGAGACCTGAGAGTGGGTGG - Intronic
1072607361 10:96996069-96996091 CTCTAAGCCCTGACACTTGGTGG - Intergenic
1072738721 10:97896774-97896796 GTCTCAGCCCTCAGTGTGGCAGG + Intronic
1073205175 10:101765316-101765338 CTCTCAGCCCTGGGGTTGAGTGG + Intergenic
1073292185 10:102418864-102418886 CTCTGGGCCCTGGGAGAGGGCGG - Exonic
1074102482 10:110364630-110364652 GTCACAGCCCTGAGGGTGTGTGG + Intergenic
1075455761 10:122583832-122583854 CTCTCTGGCCTGAGATTTGGGGG + Intronic
1075457884 10:122596535-122596557 CTCTCTGGCCTGAGATTTGGGGG + Intronic
1075915561 10:126163241-126163263 CTCTCAGCACTGAGCATGGCTGG - Intronic
1075940780 10:126388619-126388641 CGCTCACCCCCGAGGGTGGGCGG + Intergenic
1076064782 10:127440543-127440565 GTCTCAGCCCTGGGCGTCGGCGG + Intronic
1076160799 10:128242943-128242965 CTCCCTGGCCTGAGAGTGGTGGG + Intergenic
1077103679 11:832946-832968 CTCCCAGCGCTGAGAATGCGCGG - Exonic
1077281207 11:1747072-1747094 CTCGCAGCCCTGAGCTGGGGAGG + Intronic
1082027436 11:47583163-47583185 CTCTCAGCCCTCCGAGTAGCTGG + Intronic
1083458073 11:62792075-62792097 CTCCCAGCCCTGAGCGAGGGGGG - Intergenic
1083732359 11:64659487-64659509 CTCTCAACCCTGGGCATGGGTGG + Intronic
1084153652 11:67302654-67302676 CTTTCAGCCCTGAGGGGCGGAGG - Intergenic
1084674457 11:70625971-70625993 CCCTCAGCCCTCCGAGCGGGAGG - Intronic
1084929018 11:72538932-72538954 ATATGAGCCCTGAGTGTGGGAGG - Intergenic
1085256298 11:75175482-75175504 CCCTGAGCCCTGAGCCTGGGAGG - Intronic
1087828100 11:102789133-102789155 ATCTCAGCCCTCAGAGTAGCTGG + Intergenic
1088732583 11:112696230-112696252 CTCTCAGCTCTGAGAGGCCGAGG - Intergenic
1088794354 11:113255393-113255415 CACTCACCCCTGGGACTGGGAGG - Intronic
1089257504 11:117201640-117201662 CTGTCAGCCCTGAGAAAGGAAGG + Intronic
1089333570 11:117707156-117707178 CCCTCAGCCCAGAAGGTGGGTGG + Intronic
1090400319 11:126444718-126444740 GTCTCAGCCCTGAGAGTGGTGGG - Intronic
1090653196 11:128824536-128824558 GGCTCAGCCCTGGGGGTGGGGGG + Intergenic
1091053927 11:132401108-132401130 TTCTCAGCCCTGGGGGTGGCAGG + Intergenic
1091414324 12:268026-268048 GTCTCAGCCCAGAGAGAGAGGGG + Intergenic
1091588233 12:1828062-1828084 CTGTCAGTCCTGAGGGAGGGAGG - Exonic
1091785171 12:3238974-3238996 ATCTCAGCCCAGAGAGGGGTAGG + Intronic
1096702989 12:53399444-53399466 CTGTCAGCCTTGAGAGTAGCTGG + Intronic
1097153081 12:56994017-56994039 CTCACAGCCCTGTGAGGGGCTGG + Intergenic
1097278003 12:57826303-57826325 CACCCAGCCCAGAGGGTGGGGGG - Intronic
1097281140 12:57846106-57846128 CTCTCAGCCCCGAGGGGGAGGGG + Intronic
1098375152 12:69807183-69807205 CTCACATCCCAGACAGTGGGCGG + Intronic
1100149200 12:91714843-91714865 GTCTCAGCCCTGAAAGTAGCTGG - Intergenic
1101371698 12:104137519-104137541 CTGTCAGCCCTGCGAGTGCCAGG + Intronic
1102025898 12:109714249-109714271 CTCTGAGCCCCGGGTGTGGGGGG - Exonic
1104303960 12:127592633-127592655 CTCTCTCCCCTGAGAGAGAGGGG + Intergenic
1105214628 13:18277091-18277113 CTGGCAGCCCTGAGTGGGGGTGG - Intergenic
1105729681 13:23200573-23200595 CTATAAGCCCTGAGAGGGTGAGG - Intronic
1105932628 13:25067218-25067240 CTCTGAGTCCAGAGAGTAGGAGG + Intergenic
1106875509 13:34067743-34067765 CTCTCATCCCAGTGAGTGAGTGG + Intergenic
1107436934 13:40388612-40388634 CTCCCAGCCCTGAGTGCGAGAGG + Intergenic
1107801968 13:44116785-44116807 CTCTCACCCCTCAGGGTGGCTGG - Intergenic
1111072736 13:83189272-83189294 CTCCCAGCCATGTGAGTGGTTGG - Intergenic
1111658852 13:91184278-91184300 TTCTCAGCCCTGATGCTGGGAGG - Intergenic
1112796315 13:103060203-103060225 CTTTCAGCCCAGACAGTGTGTGG - Intronic
1114596565 14:23917291-23917313 CTCTTTGCCCTGAGAATAGGGGG + Intergenic
1119764970 14:77182285-77182307 GTCCCAGCCCAGAGAGTGGGCGG - Intronic
1120513607 14:85444791-85444813 CTCTCTCCCCTGTGATTGGGAGG + Intergenic
1121048743 14:90806153-90806175 CTCTCAGCCCCGGGAGGGCGAGG - Intronic
1121332040 14:93055776-93055798 CTCTCTGCCCGGGGAGTGGTAGG - Intronic
1121577009 14:94996649-94996671 TTCTCAGCCCTTAGAGGGTGGGG - Intergenic
1122072898 14:99216316-99216338 ATCTCACGACTGAGAGTGGGCGG - Intronic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1122267433 14:100553263-100553285 CTCTCAGGGCTGAGAGGCGGCGG - Intronic
1122280484 14:100619557-100619579 CTCACAGCCCTGGGAGTGGGCGG + Intergenic
1122859373 14:104575666-104575688 CCCCCAGCCCTGAGTGTGGTGGG - Intronic
1122919213 14:104873192-104873214 GGCTCAGTCCTGGGAGTGGGCGG + Intronic
1123165009 14:106318160-106318182 CTCTCAGCCCGGTGACTGGGAGG + Intergenic
1124005063 15:25789039-25789061 CCTTCAGCCCTGGGAGTTGGAGG - Intronic
1124602805 15:31149031-31149053 CTCGCAGGTCTGAGAGTGGCTGG + Intronic
1126657402 15:50993909-50993931 CTCTCACCCCTGTGGGTGGACGG + Intronic
1127368092 15:58310072-58310094 CTCTCTGCCTGGAGTGTGGGTGG - Intronic
1127866396 15:63036784-63036806 CTCCCATCACTGAGAGTGGGTGG + Intergenic
1129269102 15:74410172-74410194 CACCCAGCCATGAGAGAGGGAGG + Exonic
1129822930 15:78616984-78617006 CTGACAGCCCTGAGAGGGCGTGG + Intronic
1130004650 15:80083312-80083334 CTCCCAGCCCTGTGAATTGGTGG + Intronic
1132582199 16:690060-690082 CTGTCAGCCCTGAGGGCGGCGGG + Exonic
1132663355 16:1071178-1071200 AGCTCAGCCCTGCGGGTGGGTGG - Intergenic
1132746427 16:1438222-1438244 CTCTCAGCCCTGGGCCAGGGAGG + Intronic
1133322557 16:4923308-4923330 CTCTCAGAAAAGAGAGTGGGTGG - Intronic
1134096266 16:11420936-11420958 CTGTCATCCCAGAGGGTGGGTGG - Intronic
1134119241 16:11571972-11571994 ACCTCAGCCCTGTGAGTAGGTGG - Intronic
1135582545 16:23640977-23640999 CCCTCAGCCCTAAGAGGAGGGGG + Intronic
1136554998 16:31002314-31002336 CTCTGAGCCCTGCGGGTGGAGGG - Intronic
1136563922 16:31058301-31058323 CCCTCAGCCTTGAGAGTAGCTGG - Intergenic
1137537090 16:49335709-49335731 CTCTGAGCCCAGAGAATGAGAGG - Intergenic
1137816644 16:51404422-51404444 CTCTCTGCCCTGGGAGTGCTGGG - Intergenic
1138016722 16:53434898-53434920 CTCCCAGCCCCGAGAGGGGTGGG + Intronic
1138394291 16:56692120-56692142 TTCCCAGGCCTGAGAGTGGCAGG - Intronic
1139714016 16:68798326-68798348 CTCTGAGCCCAGCAAGTGGGAGG - Intronic
1140420721 16:74816822-74816844 CTGTGAGGCCTGAGGGTGGGAGG + Intergenic
1141355033 16:83337407-83337429 TTCTGAGTCCTGAGAATGGGAGG - Intronic
1141412557 16:83845401-83845423 CTCCCAGGCCTGAGAGTGGCGGG - Intergenic
1141616502 16:85212739-85212761 CTGTCACCCCTGCGAGTGGGCGG - Intergenic
1142203026 16:88770124-88770146 CTCTCTGCCTGGAGAGAGGGTGG - Intronic
1142292542 16:89199647-89199669 AGCTGAACCCTGAGAGTGGGCGG + Intronic
1142473640 17:177527-177549 GGCTCAGCCCTAAGACTGGGAGG - Intronic
1142742753 17:1940639-1940661 CTCCCAGCCCTGGGTGTGGAGGG - Intronic
1142986305 17:3697114-3697136 CCATCCGCCCTGAGTGTGGGAGG - Intergenic
1144856040 17:18268454-18268476 CCGGCAGCCCTGGGAGTGGGTGG - Intergenic
1144888054 17:18477347-18477369 ATCCCAACCCTGGGAGTGGGGGG - Intronic
1144970519 17:19106362-19106384 ATCTCAGCACTTTGAGTGGGTGG + Intergenic
1144990822 17:19232524-19232546 ATCTCAGCACTTTGAGTGGGTGG + Intronic
1145144153 17:20466956-20466978 ATCCCAACCCTGGGAGTGGGGGG + Intronic
1145791710 17:27631764-27631786 ATCCCAACCCTGGGAGTGGGGGG - Intronic
1148123949 17:45227411-45227433 CTCCCTGCCCTGAGTGTGAGAGG - Intronic
1149151864 17:53575143-53575165 CTCTCAGCCCCCAGAGTAGTTGG + Intergenic
1149935928 17:60806633-60806655 CTCTGAGCCCCCAGAGTTGGGGG - Intronic
1151890467 17:76948172-76948194 CCCTCAGCCCTGCCAGTGTGGGG + Intronic
1151980863 17:77507632-77507654 GTCTCAGCCCTCTGAGTGGCTGG - Intergenic
1152624109 17:81380370-81380392 CTCTGTGCCCTGAAAGTGGCTGG + Intergenic
1152800700 17:82329482-82329504 CACTCAGCCCTGACAGGGTGGGG - Intronic
1152913700 17:83020759-83020781 CTTCCAGCCCTGGGAGTGGCAGG - Intronic
1152974351 18:199595-199617 CACTCAGCCCTGTGCTTGGGGGG - Intronic
1153725223 18:7947266-7947288 CCAGCAGCCCTGACAGTGGGTGG + Intronic
1159292477 18:66440234-66440256 CTCTCAGCCCTGACACTGGGTGG - Intergenic
1159830173 18:73267555-73267577 CTCTGAGCTCGGAGAGTTGGAGG - Intergenic
1160582976 18:79898288-79898310 CTCTCAGCTCCTAGAGAGGGAGG - Intronic
1161306730 19:3573013-3573035 CTCCGGGCCCTGAGAGGGGGCGG + Intronic
1161399909 19:4062646-4062668 CTCTCAGCCCCCAGGGTAGGGGG - Intronic
1161769883 19:6225387-6225409 CTCTCTGCCTGGAGAGTGAGTGG - Intronic
1163178905 19:15584737-15584759 CTCTGAGACCTGACAGTGGTGGG - Intergenic
1163699191 19:18778724-18778746 CTCTCTGCCCCAAGAGTGTGGGG + Exonic
1163760294 19:19132807-19132829 CTCTGAGCTCTGAGGGTGGCTGG - Intronic
1164861462 19:31565268-31565290 CACTGAGCCCTGAGAGAGGCAGG - Intergenic
1165935083 19:39384231-39384253 CTCTCAGCCAAGACAGTGGCAGG + Exonic
1166054676 19:40281171-40281193 CTCACAGCTCTGGGAGTGGCAGG - Intronic
1166356768 19:42232000-42232022 CTCTCAGCCTGGAGAGGGTGGGG - Intronic
1167211623 19:48137225-48137247 CTTACTGCCCTAAGAGTGGGCGG - Intronic
1167684366 19:50946904-50946926 CTCTGTGCCCTGGGTGTGGGGGG - Intronic
926382249 2:12302335-12302357 ATCACAGGCCTGAGAGTTGGAGG + Intergenic
926709972 2:15871431-15871453 CACTCAGCCCTCAGATTGGAGGG + Intergenic
926940072 2:18126317-18126339 CTCACAGCCCTGACAGTCTGTGG + Intronic
927062455 2:19436737-19436759 CTCTCATCTCTGAGACTGGAGGG - Intergenic
928024060 2:27725426-27725448 CTCACAGCCTTGAGAGCAGGTGG - Intergenic
930385551 2:50689999-50690021 ACCTCAGCCCTGGGAGTAGGTGG + Intronic
931767894 2:65472946-65472968 CTCACAGCTCTGTGAGTGAGGGG + Intergenic
934081211 2:88469147-88469169 CTGTCAGGGCTGAGAGCGGGGGG + Intergenic
934299693 2:91769648-91769670 CTGGCAGCCCTGAGTGGGGGTGG + Intergenic
936580219 2:113693767-113693789 GTCTCAGACATGTGAGTGGGAGG - Intergenic
937128349 2:119488655-119488677 CCCTCAGCCCTGCCTGTGGGTGG - Intronic
937714948 2:125021621-125021643 CTCTCAGCTCTGTGAGGTGGAGG - Intergenic
938573671 2:132584986-132585008 CACACAGCCCTGATGGTGGGGGG - Intronic
943651331 2:190460792-190460814 TTGTCATCCCTGCGAGTGGGAGG + Intronic
946165043 2:217858622-217858644 CTCCCACCCCTGACAGTCGGAGG - Intronic
948084835 2:235238800-235238822 CTCTAAGCTCTGTGTGTGGGTGG + Intergenic
948857106 2:240735301-240735323 GTCTCAGCCCTCAGGGTGTGGGG + Intronic
1169068362 20:2707126-2707148 CCCTCTGCCCTGGGATTGGGTGG - Intronic
1170697023 20:18668465-18668487 CTCTCACCCCTAACAGTGGCAGG - Intronic
1170855711 20:20052220-20052242 CCCTCAGCCCTGAGGGTGCCCGG - Intronic
1171113865 20:22507834-22507856 CCCTCAGCCCTGTGAGAGGCAGG + Intergenic
1171507715 20:25652567-25652589 CTCTCTGCCAGCAGAGTGGGGGG + Intergenic
1173081914 20:39876464-39876486 CTGCCAGCCCTGAGTGTGAGAGG - Intergenic
1173479463 20:43387833-43387855 CTCTCAGCCCTGTGCTTGGAGGG - Intergenic
1174898617 20:54475754-54475776 CCCCCAACCCTGACAGTGGGCGG - Exonic
1175217059 20:57396844-57396866 CTTTCTGCCCTGAACGTGGGTGG - Intronic
1175891955 20:62319649-62319671 CTCTGAGCCCTGAGCCTGGCTGG + Intronic
1176198229 20:63847749-63847771 CTTCCTGCCCTGAGAGTGTGGGG - Intergenic
1176376805 21:6090798-6090820 CTCCCAGCCCTGAGAGGCTGGGG - Intergenic
1176724366 21:10417898-10417920 CTTTCAGCCATGATAGTGGGAGG + Intergenic
1178334126 21:31728915-31728937 CTCTCAGCCCTTAGGATGTGGGG + Intronic
1179746670 21:43447446-43447468 CTCCCAGCCCTGAGAGGCTGGGG + Intergenic
1179766218 21:43574953-43574975 CTGTCAGGCCTGGGAGTGGAAGG - Intronic
1181698048 22:24603744-24603766 CTGGCAGCCCTGAGTGGGGGCGG + Intronic
1181932156 22:26410616-26410638 TTTTTAGCCCTGAGAGTGGGAGG - Intergenic
1182123622 22:27801518-27801540 CTCTCGGACCTGAGGGAGGGGGG + Intergenic
1183345640 22:37306165-37306187 CCCACAGCCCTCAGGGTGGGTGG - Intronic
1183420983 22:37711037-37711059 CACTCAGGCCTGAGGGTGGAAGG - Intronic
1183663142 22:39233299-39233321 CGCTCAGTCCTGAATGTGGGGGG + Intronic
1183987754 22:41578678-41578700 CTCTCTGCCCTGAGCCGGGGAGG + Intronic
1184380146 22:44140327-44140349 TTCTCAGAGCTGAGAGTGGCTGG + Intronic
1184451694 22:44586322-44586344 CTCCTGGCCCTGGGAGTGGGTGG - Intergenic
1184552056 22:45209727-45209749 CTCCCAGCACTGAGTGTGGGGGG + Intronic
1184858319 22:47158577-47158599 CTCCCAGTCCTGTGTGTGGGAGG + Intronic
1184923709 22:47623349-47623371 CCCTGAGTCCAGAGAGTGGGAGG + Intergenic
1185105310 22:48865968-48865990 CTCCCAGCCCTAAGAGGGGCAGG + Intergenic
1185126302 22:49012589-49012611 CTCTCAGCCCAGAGCCTGGGAGG + Intergenic
950478337 3:13228047-13228069 CTCCCAGGCCTGAGAGCAGGAGG - Intergenic
950714254 3:14836579-14836601 TCCTCAGCCTTGAGGGTGGGAGG + Intronic
950916819 3:16654475-16654497 TTCTCAGCCCTGGGAGAGGAGGG + Intronic
952354478 3:32571193-32571215 CTCTCAGCCTGAACAGTGGGTGG - Intergenic
952816707 3:37452804-37452826 GTCCCAGCCCAGAGCGTGGGGGG + Intronic
952830649 3:37562066-37562088 CTCTCTGCTCTGAGAATAGGAGG - Intronic
954318466 3:49814084-49814106 GTGTCAGACCTGAGGGTGGGAGG + Intergenic
954383649 3:50233060-50233082 TTCTGAGCCCCCAGAGTGGGAGG + Intronic
954413258 3:50380516-50380538 CTCTCAGTCCTGAGTGGGTGGGG + Intronic
958927086 3:100170754-100170776 GTCTCAGCCCTCAGAGCTGGTGG + Intronic
960987666 3:123291229-123291251 CTATCAGTCCTGTGAGTGTGTGG - Exonic
961786364 3:129349606-129349628 CTCCCAGGCCTGAGAGCAGGAGG + Intergenic
966891327 3:184409559-184409581 CTCTCAGCCCTGAGCTTTGGAGG - Intronic
966932648 3:184685804-184685826 CTCTCACGGCTGAGTGTGGGGGG + Intergenic
967237496 3:187400030-187400052 CTCTCAGCCCTGAGGTGGAGAGG - Intergenic
968609992 4:1552572-1552594 CTCTCCTCCCTGAGAGTCAGTGG + Intergenic
970428090 4:15963749-15963771 CTCTCAGCTCGGTGGGTGGGAGG - Intronic
971478119 4:27091040-27091062 TTCCCAGCCCTGAGAGCGGCTGG + Intergenic
971502654 4:27333406-27333428 CACTCAGCCCTCAGGGTGGCTGG - Intergenic
972661588 4:41121760-41121782 CCCTCAGGCCTAGGAGTGGGAGG + Intronic
973613257 4:52657350-52657372 CCCGCAGCACTGAGGGTGGGTGG + Intronic
978578178 4:110206780-110206802 CTCTCTGGCCTGCGAGTGGGAGG - Intergenic
981108226 4:140905646-140905668 CTCACAGGCCTGGGATTGGGAGG - Intronic
981450224 4:144888466-144888488 CTCTCAAACCTGTGAGTGAGTGG - Intergenic
981748448 4:148072211-148072233 CAGTCAGCCCTGGGGGTGGGGGG + Exonic
983472549 4:168174465-168174487 CACTCAGCCCGCAGAGTGAGGGG - Intronic
983971467 4:173880442-173880464 CTCTCACCCCTAGAAGTGGGTGG - Intergenic
984607868 4:181805645-181805667 CTCTCAGCCCTCATGGTGGAGGG - Intergenic
985345609 4:189001633-189001655 CTCTGTCCCCTGAGAGTGAGGGG - Intergenic
985768607 5:1795213-1795235 CACTCACCCAGGAGAGTGGGAGG - Intergenic
988022118 5:25634243-25634265 CTCTCAGCCTTTAGAGTGGCCGG + Intergenic
988854298 5:35212758-35212780 CTCTCAAAACTGAGGGTGGGAGG + Intronic
989805108 5:45594149-45594171 CTCTGAGCCCTGAGAGGCTGAGG - Intronic
992687448 5:79212341-79212363 TATTCAGTCCTGAGAGTGGGTGG - Intronic
992842340 5:80708565-80708587 CTCTCAGCCCTGCAAGTAGTTGG + Intronic
997471359 5:134119020-134119042 CTCTGAGACCTGAAAGTAGGTGG + Intronic
1000285185 5:159820460-159820482 CTCCCAGCCCTGATTGTGGAGGG - Intergenic
1001293921 5:170485610-170485632 AGCTCAGCCCTGAGAGGCGGAGG - Intronic
1004730220 6:18350463-18350485 ACCTCAGCCCTCAGAGTAGGTGG - Intergenic
1005636142 6:27755160-27755182 CTCTAAGCACAGAGAGTGTGTGG - Intergenic
1006578685 6:35064135-35064157 CTCTGAGCCCTGGGCATGGGGGG + Intronic
1006876842 6:37305131-37305153 CTCCCAGGACTGAGCGTGGGGGG - Intronic
1007626937 6:43251969-43251991 CAATCCGCCCTGAGACTGGGAGG + Intronic
1007636041 6:43300375-43300397 AGCTCAGGCCGGAGAGTGGGAGG + Intronic
1007711258 6:43825800-43825822 AGCTCAGCCCTCAGAGTGGCAGG - Intergenic
1008306855 6:49913828-49913850 CTCTGCTCCCTGACAGTGGGTGG - Intergenic
1009510079 6:64539988-64540010 TTCTCAGCTCTCAGAGTAGGAGG - Intronic
1009946371 6:70346579-70346601 CTCTCAGTGCTGTGAATGGGTGG + Intergenic
1013139965 6:107322982-107323004 TTCTCACTCCTGAAAGTGGGTGG - Intronic
1015513938 6:134066377-134066399 GTCTCAGCCCTCCGAGTAGGTGG - Intergenic
1015858167 6:137647826-137647848 TTTTCAGCCCTGTGAATGGGTGG - Intergenic
1016130160 6:140458168-140458190 CTCTCTGCCCTGGGAAAGGGAGG + Intergenic
1016774194 6:147886507-147886529 CTCTCCCCCTTGAGTGTGGGTGG + Intergenic
1018380424 6:163253886-163253908 CTCCCAGCTCTGAGAGGGAGGGG + Intronic
1018579141 6:165292671-165292693 CTCTGAGCCCTGAGAAGGGATGG + Intronic
1018683423 6:166283458-166283480 CTCACAGCTCTGAGACTGGGAGG - Intergenic
1019148720 6:169990414-169990436 ATCTCAGCCCACACAGTGGGAGG + Intergenic
1019998976 7:4743989-4744011 GTCTCAGCCTTGAGAGTAGGTGG + Intronic
1021616602 7:22508272-22508294 CTTGCAGGGCTGAGAGTGGGAGG - Intronic
1022926407 7:35059485-35059507 CTTGCAGGGCTGAGAGTGGGAGG - Intergenic
1023750262 7:43365328-43365350 GTCCCAGGCCTCAGAGTGGGTGG - Intronic
1023873970 7:44276913-44276935 CGCTCAGCTCAGAGGGTGGGAGG + Intronic
1024148381 7:46540548-46540570 TTCTCTACCCTGAGAATGGGTGG + Intergenic
1024910719 7:54444247-54444269 CTCACATCCCAGACAGTGGGCGG - Intergenic
1025936727 7:66043943-66043965 CTGTCCGCCCTGAAAGTAGGTGG - Intergenic
1025947472 7:66115336-66115358 CTGTCCGCCCTGAAAGTAGGTGG + Intronic
1028375857 7:90146066-90146088 CTTGCAGGGCTGAGAGTGGGAGG + Intergenic
1029251882 7:99242837-99242859 CTCTCTGCCTTGAGAGTTAGCGG - Intergenic
1029315259 7:99706364-99706386 GACTCAGCCCTGAGAGAAGGCGG - Intronic
1029371659 7:100154629-100154651 ATCTCAGCCCTGCGGGAGGGAGG + Exonic
1029598782 7:101551630-101551652 GTCTCAGCCTTCAGAGTGGCTGG - Intronic
1029824410 7:103174170-103174192 CTTGCAGGGCTGAGAGTGGGAGG - Intergenic
1032480092 7:132239265-132239287 CTTGCAGCCCTGGGGGTGGGAGG + Intronic
1033791387 7:144795972-144795994 CTCTCAGCCCTGAGAGTGGGTGG + Intronic
1034349855 7:150408517-150408539 CTCTCAGGGCTGGGAGTGGTGGG + Intronic
1034981674 7:155482989-155483011 GTCTCAGCCCTGGGAGTGCAGGG + Intronic
1035717800 8:1767081-1767103 CTCTCAGCCATGAGGGTAGAAGG - Intronic
1037612028 8:20483909-20483931 TTCTCCTCCCTGAGAGTGAGAGG + Intergenic
1037906572 8:22719076-22719098 CTCTGACCCCTGTGGGTGGGTGG + Intronic
1043463424 8:80483072-80483094 CTCTGAGCCCTGAAAGAAGGTGG - Intergenic
1045246137 8:100443139-100443161 CTCTGAGCCCTGAGAAGGGTGGG + Intergenic
1046380626 8:113445278-113445300 GTCTCAGCCTTGAGAGTAGCTGG - Intergenic
1046404350 8:113753310-113753332 CTCAAAGGCCTGAGAATGGGAGG - Intergenic
1047973441 8:130106883-130106905 CCTGGAGCCCTGAGAGTGGGAGG + Intronic
1049425579 8:142536561-142536583 CTCACTGCCCTGGGAGTGTGGGG - Intronic
1049852347 8:144839644-144839666 CTCGCAGACCTGAGAGTCCGGGG + Intronic
1055353487 9:75413494-75413516 CTCTCAACCCTGAGAGAAGCAGG - Intergenic
1056681264 9:88721143-88721165 CTCTCCTCCCCCAGAGTGGGTGG + Intergenic
1057009500 9:91589241-91589263 CTCTCCCCCATGTGAGTGGGAGG + Intronic
1059766274 9:117386688-117386710 CACTCTGCCCTCAGAGAGGGAGG - Intronic
1060230142 9:121820014-121820036 CTCTGTGCCCTGCGGGTGGGTGG + Intergenic
1060258301 9:122052164-122052186 CTTTCAGGCCTGAAAGAGGGAGG + Intronic
1060554631 9:124501919-124501941 CTCTCAGCCCAGAGAGGAGGAGG - Intronic
1061007391 9:127935859-127935881 TTCACAGCCCTGTGTGTGGGTGG - Intronic
1061222846 9:129262280-129262302 CCCTCTGCCCAGAGAGCGGGTGG - Intergenic
1190398499 X:50008709-50008731 CTACATGCCCTGAGAGTGGGTGG + Intronic
1192435953 X:71143934-71143956 GCCTCAGCCTTGTGAGTGGGTGG + Intergenic
1192695783 X:73414556-73414578 ATCCCAGCACTGAGATTGGGAGG - Intergenic
1193398801 X:81017892-81017914 CACTGTGCCCTGAGAGTGGTTGG + Intergenic
1195650009 X:107274390-107274412 GTCACAGCATTGAGAGTGGGAGG - Intergenic
1195977132 X:110539468-110539490 CTATCAGCATTGTGAGTGGGAGG - Intergenic
1197741222 X:129895846-129895868 GTCTCAGCCTTCAGAGTGGCTGG - Intergenic
1199016310 X:142819914-142819936 CTTTCAGCGCTGTGAGGGGGGGG - Intergenic
1199853831 X:151743800-151743822 ATCTCAGCCCTGAGCTTGGCTGG - Exonic
1201362231 Y:13164877-13164899 CTCAGAGGCCTGACAGTGGGAGG + Intergenic