ID: 1033801503

View in Genome Browser
Species Human (GRCh38)
Location 7:144907497-144907519
Sequence TGGATTATGCATGTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033801503_1033801508 9 Left 1033801503 7:144907497-144907519 CCTTCCTCCACATGCATAATCCA No data
Right 1033801508 7:144907529-144907551 GGAACTTTCTTTCTGTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033801503 Original CRISPR TGGATTATGCATGTGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr