ID: 1033804392

View in Genome Browser
Species Human (GRCh38)
Location 7:144937599-144937621
Sequence AAGGGGAAGCAGAAAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033804392_1033804411 29 Left 1033804392 7:144937599-144937621 CCTTCCCCTTTCTGCTTCCCCTT No data
Right 1033804411 7:144937651-144937673 TCCTTCCTTTCCTTTCGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033804392 Original CRISPR AAGGGGAAGCAGAAAGGGGA AGG (reversed) Intergenic
No off target data available for this crispr