ID: 1033805601

View in Genome Browser
Species Human (GRCh38)
Location 7:144951321-144951343
Sequence GATCGCCATCTTCATTTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033805601_1033805603 6 Left 1033805601 7:144951321-144951343 CCTATAAAATGAAGATGGCGATC No data
Right 1033805603 7:144951350-144951372 TCTTCCCACTTCACAGTGTTGGG No data
1033805601_1033805602 5 Left 1033805601 7:144951321-144951343 CCTATAAAATGAAGATGGCGATC No data
Right 1033805602 7:144951349-144951371 CTCTTCCCACTTCACAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033805601 Original CRISPR GATCGCCATCTTCATTTTAT AGG (reversed) Intergenic
No off target data available for this crispr