ID: 1033805602

View in Genome Browser
Species Human (GRCh38)
Location 7:144951349-144951371
Sequence CTCTTCCCACTTCACAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033805601_1033805602 5 Left 1033805601 7:144951321-144951343 CCTATAAAATGAAGATGGCGATC No data
Right 1033805602 7:144951349-144951371 CTCTTCCCACTTCACAGTGTTGG No data
1033805600_1033805602 6 Left 1033805600 7:144951320-144951342 CCCTATAAAATGAAGATGGCGAT No data
Right 1033805602 7:144951349-144951371 CTCTTCCCACTTCACAGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033805602 Original CRISPR CTCTTCCCACTTCACAGTGT TGG Intergenic
No off target data available for this crispr