ID: 1033805895

View in Genome Browser
Species Human (GRCh38)
Location 7:144953907-144953929
Sequence TTGCTCCCACATCTCAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033805894_1033805895 -8 Left 1033805894 7:144953892-144953914 CCTTAAGTCATTTCTTTGCTCCC No data
Right 1033805895 7:144953907-144953929 TTGCTCCCACATCTCAGTGTAGG No data
1033805893_1033805895 -4 Left 1033805893 7:144953888-144953910 CCAACCTTAAGTCATTTCTTTGC No data
Right 1033805895 7:144953907-144953929 TTGCTCCCACATCTCAGTGTAGG No data
1033805892_1033805895 30 Left 1033805892 7:144953854-144953876 CCTTTATCATCTTCTTTCTATTT No data
Right 1033805895 7:144953907-144953929 TTGCTCCCACATCTCAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033805895 Original CRISPR TTGCTCCCACATCTCAGTGT AGG Intergenic
No off target data available for this crispr