ID: 1033807560

View in Genome Browser
Species Human (GRCh38)
Location 7:144972258-144972280
Sequence CTTGGATAGTACAATAATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033807560_1033807562 -4 Left 1033807560 7:144972258-144972280 CCTCTATTATTGTACTATCCAAG No data
Right 1033807562 7:144972277-144972299 CAAGCTTCCAGCCAATTGTGTGG No data
1033807560_1033807565 14 Left 1033807560 7:144972258-144972280 CCTCTATTATTGTACTATCCAAG No data
Right 1033807565 7:144972295-144972317 TGTGGTGCCCACCCACATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033807560 Original CRISPR CTTGGATAGTACAATAATAG AGG (reversed) Intergenic
No off target data available for this crispr