ID: 1033807869

View in Genome Browser
Species Human (GRCh38)
Location 7:144975311-144975333
Sequence CACCCCATCCTGCTTCTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033807869_1033807882 29 Left 1033807869 7:144975311-144975333 CCCATGAGAAGCAGGATGGGGTG No data
Right 1033807882 7:144975363-144975385 TGAAGCGGGGCATGTGCTATGGG No data
1033807869_1033807881 28 Left 1033807869 7:144975311-144975333 CCCATGAGAAGCAGGATGGGGTG No data
Right 1033807881 7:144975362-144975384 GTGAAGCGGGGCATGTGCTATGG No data
1033807869_1033807878 14 Left 1033807869 7:144975311-144975333 CCCATGAGAAGCAGGATGGGGTG No data
Right 1033807878 7:144975348-144975370 GAATGGGAGAGGAGGTGAAGCGG No data
1033807869_1033807877 6 Left 1033807869 7:144975311-144975333 CCCATGAGAAGCAGGATGGGGTG No data
Right 1033807877 7:144975340-144975362 AAGTACTAGAATGGGAGAGGAGG No data
1033807869_1033807880 16 Left 1033807869 7:144975311-144975333 CCCATGAGAAGCAGGATGGGGTG No data
Right 1033807880 7:144975350-144975372 ATGGGAGAGGAGGTGAAGCGGGG No data
1033807869_1033807879 15 Left 1033807869 7:144975311-144975333 CCCATGAGAAGCAGGATGGGGTG No data
Right 1033807879 7:144975349-144975371 AATGGGAGAGGAGGTGAAGCGGG No data
1033807869_1033807875 -2 Left 1033807869 7:144975311-144975333 CCCATGAGAAGCAGGATGGGGTG No data
Right 1033807875 7:144975332-144975354 TGGGAGGAAAGTACTAGAATGGG No data
1033807869_1033807876 3 Left 1033807869 7:144975311-144975333 CCCATGAGAAGCAGGATGGGGTG No data
Right 1033807876 7:144975337-144975359 GGAAAGTACTAGAATGGGAGAGG No data
1033807869_1033807874 -3 Left 1033807869 7:144975311-144975333 CCCATGAGAAGCAGGATGGGGTG No data
Right 1033807874 7:144975331-144975353 GTGGGAGGAAAGTACTAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033807869 Original CRISPR CACCCCATCCTGCTTCTCAT GGG (reversed) Intergenic
No off target data available for this crispr