ID: 1033813248

View in Genome Browser
Species Human (GRCh38)
Location 7:145042787-145042809
Sequence TACGATTCACAATGTGGTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033813248_1033813254 17 Left 1033813248 7:145042787-145042809 CCTCTACCACATTGTGAATCGTA No data
Right 1033813254 7:145042827-145042849 CCATCGCCACCTGCTTGCTTAGG No data
1033813248_1033813250 -7 Left 1033813248 7:145042787-145042809 CCTCTACCACATTGTGAATCGTA No data
Right 1033813250 7:145042803-145042825 AATCGTAAGTAACCATCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033813248 Original CRISPR TACGATTCACAATGTGGTAG AGG (reversed) Intergenic
No off target data available for this crispr