ID: 1033814253

View in Genome Browser
Species Human (GRCh38)
Location 7:145053115-145053137
Sequence ATGGCTAAAAGGCCTTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033814246_1033814253 7 Left 1033814246 7:145053085-145053107 CCTTTTCCAGGTGCATATTCTCT No data
Right 1033814253 7:145053115-145053137 ATGGCTAAAAGGCCTTTTGGAGG No data
1033814245_1033814253 8 Left 1033814245 7:145053084-145053106 CCCTTTTCCAGGTGCATATTCTC No data
Right 1033814253 7:145053115-145053137 ATGGCTAAAAGGCCTTTTGGAGG No data
1033814249_1033814253 1 Left 1033814249 7:145053091-145053113 CCAGGTGCATATTCTCTCTGGGA No data
Right 1033814253 7:145053115-145053137 ATGGCTAAAAGGCCTTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033814253 Original CRISPR ATGGCTAAAAGGCCTTTTGG AGG Intergenic
No off target data available for this crispr