ID: 1033814800

View in Genome Browser
Species Human (GRCh38)
Location 7:145058675-145058697
Sequence GTTTGTACACACAGAGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033814797_1033814800 3 Left 1033814797 7:145058649-145058671 CCCCAGAGCGGCTGATGGTACTG No data
Right 1033814800 7:145058675-145058697 GTTTGTACACACAGAGAGCTTGG No data
1033814798_1033814800 2 Left 1033814798 7:145058650-145058672 CCCAGAGCGGCTGATGGTACTGT No data
Right 1033814800 7:145058675-145058697 GTTTGTACACACAGAGAGCTTGG No data
1033814799_1033814800 1 Left 1033814799 7:145058651-145058673 CCAGAGCGGCTGATGGTACTGTT No data
Right 1033814800 7:145058675-145058697 GTTTGTACACACAGAGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033814800 Original CRISPR GTTTGTACACACAGAGAGCT TGG Intergenic
No off target data available for this crispr