ID: 1033816680

View in Genome Browser
Species Human (GRCh38)
Location 7:145082537-145082559
Sequence CTGTAATAGCTTGAGTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033816678_1033816680 12 Left 1033816678 7:145082502-145082524 CCTTTCTTGGAGCTGGGCTGTTC No data
Right 1033816680 7:145082537-145082559 CTGTAATAGCTTGAGTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033816680 Original CRISPR CTGTAATAGCTTGAGTTGGT TGG Intergenic
No off target data available for this crispr