ID: 1033824317

View in Genome Browser
Species Human (GRCh38)
Location 7:145170897-145170919
Sequence GTTCTGTCATTGGGCTAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033824312_1033824317 -10 Left 1033824312 7:145170884-145170906 CCATCACCCTTGTGTTCTGTCAT No data
Right 1033824317 7:145170897-145170919 GTTCTGTCATTGGGCTAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033824317 Original CRISPR GTTCTGTCATTGGGCTAAAC TGG Intergenic
No off target data available for this crispr