ID: 1033824728

View in Genome Browser
Species Human (GRCh38)
Location 7:145175482-145175504
Sequence AGCTTCAGATAGAAGAACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033824727_1033824728 0 Left 1033824727 7:145175459-145175481 CCTATGTCAGCAAGGGTAGGAAC No data
Right 1033824728 7:145175482-145175504 AGCTTCAGATAGAAGAACTCTGG No data
1033824723_1033824728 29 Left 1033824723 7:145175430-145175452 CCAGGGAAGAAAAAGCACTTTCA No data
Right 1033824728 7:145175482-145175504 AGCTTCAGATAGAAGAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033824728 Original CRISPR AGCTTCAGATAGAAGAACTC TGG Intergenic
No off target data available for this crispr