ID: 1033824980

View in Genome Browser
Species Human (GRCh38)
Location 7:145178552-145178574
Sequence CTGTGGGCCCCTGGAGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033824974_1033824980 10 Left 1033824974 7:145178519-145178541 CCACTTCTTAAAAAGTATAGATT No data
Right 1033824980 7:145178552-145178574 CTGTGGGCCCCTGGAGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033824980 Original CRISPR CTGTGGGCCCCTGGAGGTCC AGG Intergenic
No off target data available for this crispr