ID: 1033832247

View in Genome Browser
Species Human (GRCh38)
Location 7:145268769-145268791
Sequence CTAAGTCAACAGCAATATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033832247_1033832253 -6 Left 1033832247 7:145268769-145268791 CCCATATATTGCTGTTGACTTAG No data
Right 1033832253 7:145268786-145268808 ACTTAGTGTCTCCATGGGAGGGG No data
1033832247_1033832252 -7 Left 1033832247 7:145268769-145268791 CCCATATATTGCTGTTGACTTAG No data
Right 1033832252 7:145268785-145268807 GACTTAGTGTCTCCATGGGAGGG No data
1033832247_1033832256 16 Left 1033832247 7:145268769-145268791 CCCATATATTGCTGTTGACTTAG No data
Right 1033832256 7:145268808-145268830 GGAAAAACCCTGTAGCTTCCTGG No data
1033832247_1033832254 -5 Left 1033832247 7:145268769-145268791 CCCATATATTGCTGTTGACTTAG No data
Right 1033832254 7:145268787-145268809 CTTAGTGTCTCCATGGGAGGGGG No data
1033832247_1033832251 -8 Left 1033832247 7:145268769-145268791 CCCATATATTGCTGTTGACTTAG No data
Right 1033832251 7:145268784-145268806 TGACTTAGTGTCTCCATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033832247 Original CRISPR CTAAGTCAACAGCAATATAT GGG (reversed) Intergenic
No off target data available for this crispr