ID: 1033832667

View in Genome Browser
Species Human (GRCh38)
Location 7:145272325-145272347
Sequence GTGAGAATCTTCAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033832662_1033832667 22 Left 1033832662 7:145272280-145272302 CCTGTTAAGCATAATAGAGATAA No data
Right 1033832667 7:145272325-145272347 GTGAGAATCTTCAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033832667 Original CRISPR GTGAGAATCTTCAGGGAAGA GGG Intergenic
No off target data available for this crispr