ID: 1033834108

View in Genome Browser
Species Human (GRCh38)
Location 7:145288113-145288135
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033834099_1033834108 4 Left 1033834099 7:145288086-145288108 CCTTAATACTTAATATTATTTGG No data
Right 1033834108 7:145288113-145288135 GATTATGAAAAGGGGGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033834108 Original CRISPR GATTATGAAAAGGGGGCTCA AGG Intergenic
No off target data available for this crispr