ID: 1033834723

View in Genome Browser
Species Human (GRCh38)
Location 7:145295681-145295703
Sequence TAGGAAACCTTGCTCCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033834723_1033834727 2 Left 1033834723 7:145295681-145295703 CCTCAGTGGAGCAAGGTTTCCTA No data
Right 1033834727 7:145295706-145295728 GAAAAGGGTTCCACGTGAAATGG No data
1033834723_1033834728 3 Left 1033834723 7:145295681-145295703 CCTCAGTGGAGCAAGGTTTCCTA No data
Right 1033834728 7:145295707-145295729 AAAAGGGTTCCACGTGAAATGGG No data
1033834723_1033834732 27 Left 1033834723 7:145295681-145295703 CCTCAGTGGAGCAAGGTTTCCTA No data
Right 1033834732 7:145295731-145295753 CTTCCTTGGCTTCTTCCAGTGGG No data
1033834723_1033834731 26 Left 1033834723 7:145295681-145295703 CCTCAGTGGAGCAAGGTTTCCTA No data
Right 1033834731 7:145295730-145295752 TCTTCCTTGGCTTCTTCCAGTGG No data
1033834723_1033834730 13 Left 1033834723 7:145295681-145295703 CCTCAGTGGAGCAAGGTTTCCTA No data
Right 1033834730 7:145295717-145295739 CACGTGAAATGGGTCTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033834723 Original CRISPR TAGGAAACCTTGCTCCACTG AGG (reversed) Intergenic