ID: 1033836133

View in Genome Browser
Species Human (GRCh38)
Location 7:145314604-145314626
Sequence GATCTGAGCAGTTTAACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033836133_1033836136 18 Left 1033836133 7:145314604-145314626 CCAGGTGTTAAACTGCTCAGATC No data
Right 1033836136 7:145314645-145314667 TTTTAATTTTTTTTTAGAGACGG 0: 25
1: 679
2: 4910
3: 111990
4: 163705

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033836133 Original CRISPR GATCTGAGCAGTTTAACACC TGG (reversed) Intergenic
No off target data available for this crispr