ID: 1033845578

View in Genome Browser
Species Human (GRCh38)
Location 7:145427910-145427932
Sequence GTGTATCAGCAGAAACCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033845571_1033845578 25 Left 1033845571 7:145427862-145427884 CCAAGTGAGGGCAGTAATGTGAA No data
Right 1033845578 7:145427910-145427932 GTGTATCAGCAGAAACCAAGTGG No data
1033845574_1033845578 -3 Left 1033845574 7:145427890-145427912 CCTACTCTTCCCAGCCAAGGGTG No data
Right 1033845578 7:145427910-145427932 GTGTATCAGCAGAAACCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033845578 Original CRISPR GTGTATCAGCAGAAACCAAG TGG Intergenic
No off target data available for this crispr