ID: 1033845927

View in Genome Browser
Species Human (GRCh38)
Location 7:145432111-145432133
Sequence GATGCAACAATATTGAAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1855
Summary {0: 10, 1: 55, 2: 335, 3: 638, 4: 817}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033845927_1033845932 17 Left 1033845927 7:145432111-145432133 CCTAATTTCAATATTGTTGCATC 0: 10
1: 55
2: 335
3: 638
4: 817
Right 1033845932 7:145432151-145432173 CTGAGGAGAAGGAGAGATGAGGG No data
1033845927_1033845931 16 Left 1033845927 7:145432111-145432133 CCTAATTTCAATATTGTTGCATC 0: 10
1: 55
2: 335
3: 638
4: 817
Right 1033845931 7:145432150-145432172 CCTGAGGAGAAGGAGAGATGAGG No data
1033845927_1033845928 0 Left 1033845927 7:145432111-145432133 CCTAATTTCAATATTGTTGCATC 0: 10
1: 55
2: 335
3: 638
4: 817
Right 1033845928 7:145432134-145432156 TCAGAGAATAAGAAGTCCTGAGG No data
1033845927_1033845929 6 Left 1033845927 7:145432111-145432133 CCTAATTTCAATATTGTTGCATC 0: 10
1: 55
2: 335
3: 638
4: 817
Right 1033845929 7:145432140-145432162 AATAAGAAGTCCTGAGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033845927 Original CRISPR GATGCAACAATATTGAAATT AGG (reversed) Intergenic
901751047 1:11408903-11408925 GACACAATAATATTGCAATTAGG + Intergenic
901949434 1:12730375-12730397 ATTTCAACAATATTGAAATTTGG - Intergenic
902928265 1:19712123-19712145 GACACAACAGTATTGAAATTAGG - Intronic
903092326 1:20932571-20932593 GATACAACAATATTGAAATTAGG - Intronic
903097113 1:20987738-20987760 GACACAATAATATTGAAGTTAGG + Intronic
903561107 1:24228586-24228608 GACACAGCAATATTGAAATTAGG - Intergenic
903597943 1:24510910-24510932 GACACGACAATATTGAAATTAGG - Intronic
903881189 1:26510589-26510611 GATAAAACAATATTGAAATTAGG + Intergenic
904202477 1:28830057-28830079 GACACAACAATATTGAAATTAGG - Intronic
904577807 1:31516629-31516651 GACCCAACAATATTAAAATTAGG + Intergenic
904580880 1:31543464-31543486 GATACAACAATATTGAAATTAGG - Intergenic
904665396 1:32116845-32116867 GATACAACAATATTGAAATGAGG - Intronic
904761282 1:32806043-32806065 AACACAACAATATTGAAATTAGG - Intronic
904776993 1:32915754-32915776 GTCAAAACAATATTGAAATTGGG - Intergenic
904862973 1:33553495-33553517 GACCCACCAATATTGAAATTAGG + Intronic
905144230 1:35874554-35874576 GACACAACAATACTGAAAGTAGG + Intronic
905188916 1:36217871-36217893 GACACAACAACATTGACATTAGG + Intergenic
905545087 1:38791365-38791387 GATGTAACAATAAAAAAATTTGG - Intergenic
905757070 1:40519680-40519702 GATGCAACTATTTTGGAATCTGG + Intergenic
906269832 1:44467917-44467939 GACACAACGATATTGAAATTAGG - Intronic
906681233 1:47726914-47726936 GATCCTATAATATTAAAATTTGG - Intergenic
906802928 1:48753144-48753166 GAGGCAACAAAATTTGAATTTGG + Intronic
906838915 1:49114716-49114738 GACACAACAATATTAAAATTAGG - Intronic
907019426 1:51052057-51052079 GACACAAGAATATTGAAATTAGG - Intergenic
907033992 1:51200108-51200130 GACATGACAATATTGAAATTAGG - Intergenic
907112923 1:51943058-51943080 GACACAACAGTATTAAAATTAGG + Intronic
907649366 1:56280020-56280042 GATGCAACAATATTGAAATTAGG - Intergenic
907652377 1:56307605-56307627 GATGCAACAATATTAAAATTAGG + Intergenic
907685082 1:56602718-56602740 GACACAATAATATTGCAATTAGG + Intronic
907802486 1:57783934-57783956 GATACAACAATACTGAAATTAGG + Intronic
908091656 1:60692175-60692197 GACACAAGAATGTTGAAATTAGG + Intergenic
908221497 1:62011373-62011395 GACACAACAATATTAAAGTTAGG - Intronic
908333250 1:63093033-63093055 GACACAACAATATTGAAATTAGG - Intergenic
908340775 1:63176593-63176615 CACACAACAATATTGAAATTAGG - Intergenic
908397744 1:63741583-63741605 GAAACAACAATATTAAAATTAGG + Intergenic
908432778 1:64074834-64074856 GATGGAAAAAAATTGAGATTTGG - Intronic
908464862 1:64383490-64383512 GATACAAAAATATTGAAATTAGG + Intergenic
908483449 1:64566784-64566806 CATGCAACAATATTGTAATTGGG + Intronic
908689692 1:66764405-66764427 GACACAACAATATTGAAATTAGG - Intronic
908869799 1:68596316-68596338 GACACAACAATATCAAAATTAGG + Intergenic
908893184 1:68868908-68868930 GACACAACAATATTAAAATTAGG - Intergenic
908893614 1:68874009-68874031 GAAACAACAGTATTGAAATTGGG + Intergenic
908921930 1:69205374-69205396 GACACAATAATACTGAAATTTGG - Intergenic
909088454 1:71195713-71195735 GACACTACAATATTGAAATTTGG - Intergenic
909139673 1:71847691-71847713 GAGACAAAAATATTGAAATTAGG + Intronic
909164528 1:72202295-72202317 GACACAACAATATTAAAATTAGG + Intronic
909220309 1:72950985-72951007 GAAACAACAATATTGTAATTAGG - Intergenic
909365802 1:74820451-74820473 GAAACAACAATATTAAAATTAGG - Intergenic
909796651 1:79748032-79748054 GACACAACAATATTGAAAATAGG - Intergenic
909844058 1:80368104-80368126 GATACAACAATATTAAAATTGGG + Intergenic
909888981 1:80979264-80979286 GAGAAAACAGTATTGAAATTAGG - Intergenic
910068118 1:83178312-83178334 GACACAACAATATGGAAACTAGG - Intergenic
910078444 1:83309132-83309154 GGTGCAACAATATTGAAATTGGG - Intergenic
910163218 1:84296557-84296579 GACACAACAATATTGAAATTCGG - Intergenic
910200448 1:84692851-84692873 GACACAGCAATATTAAAATTAGG + Intergenic
910269822 1:85381968-85381990 GACATAGCAATATTGAAATTAGG + Intronic
910298411 1:85676599-85676621 GACACAATAATATTGAAATTAGG - Intronic
910411766 1:86953852-86953874 TATACAACAATATTGAAATTAGG - Intronic
910556883 1:88544247-88544269 GATGAGACAATATTGAAAATTGG + Intergenic
910640084 1:89450929-89450951 GACACAACAATATTGAAATTAGG + Intergenic
910732700 1:90415397-90415419 GATACAATAATATTGAGATTAGG + Intergenic
910755669 1:90687851-90687873 GACACAATAATATTGAAATTAGG - Intergenic
910782584 1:90956024-90956046 GACACAACAGTATTGAAATTAGG - Intronic
910787850 1:91020796-91020818 GATGCAACAAGCGTGGAATTAGG + Intronic
910918307 1:92315185-92315207 GACACAACAATATTGAAATTAGG - Intronic
910983407 1:92980962-92980984 GGCACAACAATATTGGAATTAGG + Intergenic
910992468 1:93070292-93070314 GACACAAAAGTATTGAAATTAGG + Intergenic
911199105 1:95026416-95026438 GACACAACAATATTGAAATTAGG - Intronic
911402540 1:97394371-97394393 GATGCGACAATATTGAAATTAGG - Intronic
911460135 1:98179182-98179204 AATGCAAGTATATTGAAATAGGG - Intergenic
911591402 1:99752397-99752419 GGCACAACAATATTGAAATTGGG - Intronic
911611992 1:99968191-99968213 TAAACAGCAATATTGAAATTAGG - Intergenic
911649635 1:100373214-100373236 GACACAACAATATTGAAATCAGG - Intronic
911676340 1:100662862-100662884 AATGCTACAATATTAAAATATGG - Intergenic
911706281 1:101016854-101016876 GACCCAACAATATTGAAGTTAGG - Intronic
911832009 1:102562294-102562316 GACAAAACAATTTTGAAATTAGG + Intergenic
911868416 1:103058645-103058667 GACACAGCAATATTGAAATTAGG - Intronic
911928926 1:103875131-103875153 GATACAACAACTTTGAAATTAGG - Intergenic
911969894 1:104419277-104419299 AACACAACAATATTAAAATTAGG - Intergenic
912032765 1:105270304-105270326 GACATAACAATATTAAAATTAGG + Intergenic
912307187 1:108580340-108580362 GACAAAACAATATTAAAATTAGG + Intronic
912642106 1:111356774-111356796 GACAGAACAAAATTGAAATTAGG - Intergenic
912874010 1:113337361-113337383 GACAGAACAATATTGAAATTAGG - Intergenic
912954137 1:114141054-114141076 GGCACAACAATATTGAAATTAGG + Intronic
912989448 1:114470542-114470564 GACCAAACAATATTGAAATTAGG + Intronic
913127022 1:115801030-115801052 GACACAACAATATTGAAATTAGG - Intergenic
913345072 1:117800798-117800820 GACACAGCAATATTGAAATTAGG - Intergenic
913350934 1:117858295-117858317 GACACAGCAATACTGAAATTAGG + Intergenic
913679343 1:121173774-121173796 GATACAACAATATTGAAATTGGG + Intronic
914031174 1:143961423-143961445 GATACAACAATATTGAAATTGGG + Intronic
914158274 1:145106540-145106562 GATACAACAATATTGAAATTGGG - Intronic
914356915 1:146894447-146894469 GACATAACAACATTGAAATTAGG - Intergenic
914415159 1:147473475-147473497 GACACACCAATATTGAAATTAGG + Intergenic
914709726 1:150202115-150202137 GACACAACGACATTGAAATTAGG - Intergenic
914774564 1:150724711-150724733 GACACAGCAATATTTAAATTAGG - Intergenic
914776300 1:150738869-150738891 GACACAATGATATTGAAATTAGG + Intronic
915006549 1:152643444-152643466 GACACAACAGTATTGAAATTAGG - Intergenic
915032175 1:152890296-152890318 GACACAACACTATTAAAATTAGG - Intergenic
915600027 1:156916510-156916532 GACACAACAATATTGAAATGAGG + Intergenic
915909599 1:159905642-159905664 GACCCAACAATATTGAAATTAGG - Intergenic
916169703 1:161992635-161992657 CACACAACAATATTGAAATTAGG - Intronic
916191578 1:162184119-162184141 GACACAATAATATTGAAATTAGG - Intronic
916553127 1:165869003-165869025 GACAGAACAATATTGAAGTTAGG - Intronic
916669333 1:166999067-166999089 GACACAACAATATTGAAATTAGG + Intronic
916800195 1:168208678-168208700 GACACAACAATATTGAAATTAGG - Intergenic
917112079 1:171558732-171558754 AACACAACAATGTTGAAATTAGG + Intronic
917353573 1:174103290-174103312 GATACAACAAAATTGAAATTAGG + Intergenic
917362371 1:174190896-174190918 AACACAACAATATTGAAAATAGG - Intronic
917546192 1:175971113-175971135 GATGCAACAATAATGATTCTGGG + Intronic
917669461 1:177258908-177258930 GACACAACAATATTGAAATTAGG + Intronic
917842999 1:178997601-178997623 GACACAGCAATACTGAAATTAGG - Intergenic
917861427 1:179148593-179148615 GACACAACAATACTGAAATTAGG + Intronic
917950903 1:180034810-180034832 GACACAATAATATTAAAATTAGG + Intronic
917983963 1:180295843-180295865 GACACAATAATATTGAAATTAGG + Intronic
918130690 1:181625951-181625973 GACACAACAATATTGAAATTGGG - Intronic
918195848 1:182220476-182220498 GATTCACCAAGATTGAAATGAGG + Intergenic
918392109 1:184076466-184076488 GAAACAGCAATATTGAAATTAGG + Intergenic
918632519 1:186735073-186735095 GACACAACAATATTGAAATCAGG - Intergenic
918916546 1:190647736-190647758 GAAGCAATAATATTGACTTTTGG - Intergenic
918975950 1:191486713-191486735 TATACAACAATATTGAAATGAGG - Intergenic
919093897 1:193006620-193006642 GACACAACAATATTGAAATTAGG - Intergenic
919200085 1:194345054-194345076 GACACAACATTATTAAAATTAGG - Intergenic
919204066 1:194397519-194397541 GATATAAAGATATTGAAATTAGG - Intergenic
919282131 1:195503898-195503920 GCCACAACAATATTGAAAGTAGG - Intergenic
919288291 1:195594527-195594549 GACACAGCAATATTGAAATTAGG - Intergenic
919415221 1:197300138-197300160 GACTAAACAATATTGAAATTAGG + Intronic
919448825 1:197745401-197745423 GACACAACAACATTGAAATTAGG - Intronic
919545881 1:198917900-198917922 GACACAGCAATATTGAAATTAGG + Intergenic
920041086 1:203097833-203097855 AATGCAACAATATTGAGAGGTGG - Intronic
920050065 1:203158994-203159016 AATGCAACAATGTTGAAAGGTGG - Intronic
920120483 1:203652865-203652887 GACACAACAATATTGAAAGTAGG + Intronic
920447101 1:206026044-206026066 GACACAACAATATTGAAATTAGG + Intergenic
920466644 1:206192317-206192339 GATACAACAATATTGAAATTGGG + Intronic
920538332 1:206756627-206756649 GATGTAACAATATTGAAATTAGG - Intergenic
920662751 1:207931515-207931537 GATATGACAATAATGAAATTAGG - Intergenic
920799217 1:209172160-209172182 GACACAATAATATTAAAATTAGG + Intergenic
920824061 1:209408392-209408414 GATGAAACAATAGTGACATGTGG - Intergenic
921091037 1:211843369-211843391 GGCACAACAAAATTGAAATTAGG - Intergenic
921141894 1:212316071-212316093 GACACAACAAAATTGAGATTAGG + Intronic
921210407 1:212891635-212891657 GGCACAACAATATTGAAATCAGG + Intronic
921276190 1:213523118-213523140 AACACAACAATATTGAAATTAGG - Intergenic
921303953 1:213777360-213777382 GAAACAACAATATTGAAATTAGG - Intergenic
921313903 1:213872640-213872662 GACACAATAGTATTGAAATTAGG + Intergenic
921379519 1:214510082-214510104 GACACAACAATATTGAAATTAGG - Intronic
921398725 1:214696334-214696356 CATCCAACAATATTGAAATTGGG + Intergenic
921408251 1:214805734-214805756 GACACAACAATATTGACATTAGG + Intergenic
921571679 1:216787279-216787301 GACACAACAATATTGAAATAAGG + Intronic
921737646 1:218646672-218646694 GATGTCAGAATATTGAACTTTGG + Intergenic
921828861 1:219704354-219704376 GACACAATAATATTGAAATTAGG + Intronic
921897658 1:220417104-220417126 GACCCAACAATATTGAAATTAGG + Intergenic
921908156 1:220517270-220517292 GACATAACAATATTGAAATTAGG + Intergenic
922032467 1:221814884-221814906 CAGACAACAATATTGAAATTAGG + Intergenic
922578784 1:226681641-226681663 AATGCAAAAATATGCAAATTGGG - Intronic
922588649 1:226755260-226755282 GAAACAATAATATTGAAATCAGG + Intergenic
922659144 1:227414040-227414062 GATACAACAGTATTAAAATTAGG - Intergenic
922823400 1:228500692-228500714 CACACAACAATACTGAAATTGGG - Intergenic
922903124 1:229153792-229153814 GATACAACACAATTGAAATTAGG - Intergenic
922959225 1:229631578-229631600 GACGCAATAATATTGCAATTAGG - Intronic
923014690 1:230117532-230117554 GATACCACGATACTGAAATTAGG - Intronic
923294124 1:232576522-232576544 GACACAACAATATTGAACGTAGG + Intergenic
923481262 1:234386551-234386573 GAGACAACAATATTGAAATTAGG - Intergenic
923525549 1:234769891-234769913 TATGCAACAATATATACATTAGG - Intergenic
923763168 1:236866460-236866482 GACACAACAATATTGAAATTAGG + Intronic
923936455 1:238765694-238765716 GATGCAACAATATTGAAATCAGG - Intergenic
923952399 1:238972184-238972206 GACTCAACAATATTGAAATTAGG - Intergenic
924006828 1:239621306-239621328 GTCACAACAATATTGAAATTAGG + Intronic
924080582 1:240393507-240393529 GACACAACAATATTGAAATTAGG + Intronic
924451869 1:244185884-244185906 GATGCAGAAACATAGAAATTCGG + Intergenic
924689464 1:246332036-246332058 GACACAACAATATTGAAATTAGG + Intronic
924833376 1:247622434-247622456 GACACAACAATATGAAAATTAGG + Intergenic
1062777220 10:162119-162141 GACACAACAATAATGAAATCCGG - Intronic
1062890223 10:1053898-1053920 GACACAGCAATACTGAAATTAGG - Intronic
1062897148 10:1112425-1112447 GACACAACACTGTTGAAATTAGG + Intronic
1062933109 10:1365391-1365413 GAAGCCCCAATATTGAAATTAGG + Intronic
1062997198 10:1877669-1877691 GATGCAATAATATTAAGATAAGG - Intergenic
1063027441 10:2194207-2194229 CATTCAACAATATTGTAATCTGG - Intergenic
1063217133 10:3934782-3934804 GCTGGAACAATCTTGATATTAGG + Intergenic
1063236561 10:4122890-4122912 GACACAATAATATTAAAATTAGG + Intergenic
1063247068 10:4232195-4232217 GACACAATAATATTGATATTAGG + Intergenic
1063337623 10:5231690-5231712 GAAACAACAACATTGAAATTAGG - Intergenic
1063802011 10:9590684-9590706 GACACAACAATATTAAAATTAGG - Intergenic
1063821133 10:9837372-9837394 GATACAGCAATACTGAAGTTAGG + Intergenic
1064917467 10:20476413-20476435 GAGACAGAAATATTGAAATTAGG + Intergenic
1064949948 10:20837035-20837057 GTCAAAACAATATTGAAATTGGG + Intronic
1065032913 10:21606216-21606238 GACACAACAATATTGAATGTAGG + Intronic
1065064812 10:21950477-21950499 GACACAACAATATTGAAATTAGG + Intronic
1065402722 10:25324343-25324365 CACACAACAATATTGAAATCAGG - Intronic
1065413716 10:25461098-25461120 GACATAACAATGTTGAAATTAGG + Intronic
1065546654 10:26828135-26828157 GATGCAACAATATTGAAATTGGG - Intronic
1065687292 10:28299314-28299336 GACACAACAATATTGAAATTAGG - Intronic
1065899573 10:30193344-30193366 GACACAACAATACTGAAATTAGG + Intergenic
1066043369 10:31575668-31575690 GACACAAAAATATTGAAATTAGG + Intergenic
1066050895 10:31633890-31633912 GAGACACCAATATTGAAATTAGG + Intergenic
1066057153 10:31692639-31692661 GACAAAACATTATTGAAATTAGG - Intergenic
1066134942 10:32436049-32436071 GACACAACAATATTGAAATAGGG - Intergenic
1066237923 10:33505015-33505037 GACACAACAATACTGAAATTAGG - Intergenic
1066266895 10:33784708-33784730 GACACAAAAATACTGAAATTAGG + Intergenic
1066285535 10:33962535-33962557 GACACAACAGTGTTGAAATTAGG - Intergenic
1066374683 10:34846958-34846980 GACACAACAATATTGAAATTAGG + Intergenic
1066478965 10:35776990-35777012 GATGCAAGAATATTGAAATTAGG - Intergenic
1066479204 10:35779225-35779247 GACAAAACAATATTGAAATTGGG - Intergenic
1066531189 10:36341399-36341421 GACACAAAAATATTAAAATTAGG + Intergenic
1067119734 10:43463967-43463989 GACACAACAATATTGAAATTAGG + Intronic
1067301897 10:45019291-45019313 AACACAACAATACTGAAATTAGG - Intergenic
1067404269 10:46006852-46006874 GACAAAACAAGATTGAAATTAGG + Intronic
1067548138 10:47211248-47211270 GAAACAACAATATTAAAATTAGG + Intergenic
1068197705 10:53739667-53739689 AAGACAACAATATTGAAATCAGG - Intergenic
1068559136 10:58493469-58493491 AATACAACAATATTGAAATTAGG + Intergenic
1068700380 10:60013644-60013666 GACACAATGATATTGAAATTAGG - Intergenic
1068748716 10:60566268-60566290 GATACAATAATATTGAAATTAGG + Intronic
1068940895 10:62680123-62680145 AACACAAAAATATTGAAATTTGG - Intergenic
1069067264 10:63955742-63955764 GACACAACAATATTGAATTTGGG - Intergenic
1069087139 10:64154089-64154111 GATACAAAAATATTTAAATTAGG - Intergenic
1069126563 10:64642456-64642478 GACACAACAATGTTGAAATTAGG + Intergenic
1069319056 10:67145015-67145037 GAAACAACAATATTGAAATTAGG - Intronic
1069417778 10:68216431-68216453 GACTCAGCAATATTGAAATTAGG + Intergenic
1069736390 10:70657747-70657769 GACACAACAATATTGGAATTAGG + Intergenic
1069947186 10:71995629-71995651 AATGCAACAATATTGAAATTAGG - Intronic
1069968427 10:72142665-72142687 GATGCAAGAATAGTGAAATCTGG - Intronic
1070218531 10:74413895-74413917 GACACAACAATAGTGACATTAGG - Intronic
1070315448 10:75306959-75306981 GACACAATAATATTGAAATTAGG + Intergenic
1070360835 10:75687091-75687113 GACAAAACAATATAGAAATTAGG + Intronic
1070420786 10:76235139-76235161 GACACAACGATATTGAAATTAGG - Intronic
1070648446 10:78217921-78217943 AATGCAAGAAGATTCAAATTTGG - Intergenic
1070944787 10:80380958-80380980 GACACAACAATATTGAAATTAGG - Intergenic
1071225516 10:83524074-83524096 GATGAAACTATATTCAAAATGGG - Intergenic
1071226149 10:83530576-83530598 GAAGCAACAATATTCAAATCAGG - Intergenic
1071438836 10:85671584-85671606 CACACAACAATATTGAAATTAGG + Intronic
1071683314 10:87729572-87729594 GATCCAACAATATTTGAATTAGG + Intronic
1071691761 10:87827732-87827754 GACACAACAATATTGAAATTAGG + Intronic
1071763863 10:88639737-88639759 GAGGCAACAATATTTAAAGCAGG - Intergenic
1071854237 10:89607240-89607262 GACACAGCAATATTGAAATTAGG - Intronic
1071871828 10:89803989-89804011 GATACATCAATATTGAAATTAGG - Intergenic
1071971186 10:90908734-90908756 AACAAAACAATATTGAAATTAGG + Intergenic
1072059575 10:91797079-91797101 AACACAATAATATTGAAATTAGG - Intergenic
1072151099 10:92684719-92684741 GAGACAACAATATTGAAATTGGG + Intergenic
1072184820 10:93026836-93026858 GAGGTAACAATATTGAAATTAGG + Intronic
1073598980 10:104828316-104828338 GACACAACAATACTGAATTTAGG - Intronic
1073662203 10:105488912-105488934 CATGCAACAGCATTAAAATTAGG - Intergenic
1073681502 10:105709121-105709143 GACACAACTATATTGAAATTAGG + Intergenic
1073696311 10:105873024-105873046 GATAAAACAATATTGAAATTAGG - Intergenic
1073831411 10:107387866-107387888 GATAAAACAATATTGAATATTGG - Intergenic
1074033168 10:109709504-109709526 GACACAACAACATTGAAATTAGG - Intergenic
1074090910 10:110254413-110254435 GACACAGCTATATTGAAATTAGG + Intronic
1074474591 10:113758678-113758700 GACTCAACAATATTGAAATTAGG - Intronic
1074607281 10:114985808-114985830 GACACAACAGTATTGAAATTAGG - Intergenic
1074691472 10:116008760-116008782 GACACAACAATATTGAAATTGGG + Intergenic
1074905263 10:117856791-117856813 GACATAATAATATTGAAATTAGG - Intergenic
1075179505 10:120197213-120197235 GACACAACAATATTGAAATTAGG - Intergenic
1075186138 10:120259691-120259713 GACACAAGAATATTGAAATGAGG - Intergenic
1075354524 10:121758979-121759001 AACACAACAATATTGAAATTAGG + Intronic
1075751285 10:124773554-124773576 GACACAGCAATATTGAAATTAGG - Intronic
1075841083 10:125504209-125504231 GACACAGCAATATTGAAATTAGG + Intergenic
1075847760 10:125559200-125559222 GACGCAACAGTATTGAAATTAGG + Intergenic
1076276405 10:129203059-129203081 GACAAAACAATATTGAAATTAGG - Intergenic
1076742690 10:132494824-132494846 GACACAGCAGTATTGAAATTAGG + Intergenic
1077682265 11:4253060-4253082 TAGGCAACAATAATGAAAATTGG - Intergenic
1077756904 11:5041006-5041028 GACACAACAATATCAAAATTTGG + Intergenic
1077824725 11:5793806-5793828 GGCACAACAATATTGAAATTAGG + Intronic
1078117816 11:8472437-8472459 TACACAAAAATATTGAAATTAGG - Intronic
1078398936 11:11007019-11007041 AACACAACAATATTGATATTAGG - Intergenic
1078630858 11:13002720-13002742 TATGCAACACTATGGAAAATGGG - Intergenic
1078784341 11:14473506-14473528 GATACCACAATATTGAAATTAGG - Intronic
1078847891 11:15138028-15138050 GATACAACAATATTAAAATCTGG - Intronic
1078951058 11:16134804-16134826 GAGACAACAATATTGAAATTAGG + Intronic
1078974877 11:16462289-16462311 GAAGCTTCAATATTGCAATTTGG + Intronic
1078975846 11:16475455-16475477 GGCACAACAATATTGAAATTGGG - Intronic
1078995872 11:16698711-16698733 AACACAACAATATTGAAATTAGG - Intronic
1079132914 11:17759622-17759644 GACACAACAATATTGAAATTAGG - Intronic
1079158413 11:17970441-17970463 GACAAAACAATATTGAAATTAGG + Intronic
1079325873 11:19491912-19491934 GACACAACAATACTAAAATTAGG - Intronic
1079786004 11:24673618-24673640 AATTCAGCAATATTGACATTGGG + Intronic
1079801088 11:24869780-24869802 GACACAACAATATTGAAATTAGG + Intronic
1079832432 11:25285207-25285229 GAAACAACAACATTAAAATTAGG - Intergenic
1079890773 11:26050062-26050084 GACACAACAATATTGAAATCTGG + Intergenic
1079975475 11:27085616-27085638 GAGACAACAATATTTAAGTTAGG + Intronic
1080064454 11:27994268-27994290 GACACAACAATATTGAAATTAGG + Intergenic
1080359116 11:31492680-31492702 GACATAACAATATTGAAATTAGG - Intronic
1080543870 11:33296804-33296826 GACACAACAATATTGAAAGTAGG + Intronic
1080842320 11:35996249-35996271 GACGCAACAATAATGGAATTAGG - Intronic
1080972113 11:37290247-37290269 GATACAAAAATATAGAAATCAGG - Intergenic
1081071616 11:38616931-38616953 GACACAAAAGTATTGAAATTAGG - Intergenic
1081212069 11:40347951-40347973 GAGACAACAGTATTGAAACTAGG - Intronic
1081266185 11:41025116-41025138 GACAAAACAATATTGAAATTAGG + Intronic
1081457318 11:43236688-43236710 GACACAATAATATTAAAATTAGG + Intergenic
1081886632 11:46503271-46503293 TACACAGCAATATTGAAATTAGG - Intronic
1082200026 11:49355327-49355349 GACAAAACAATATTGAATTTAGG - Intergenic
1082230020 11:49752267-49752289 GACAGAACAATATTGAAGTTAGG + Intergenic
1082232859 11:49790356-49790378 GACACAACAGTATTAAAATTAGG - Intergenic
1083040121 11:59677830-59677852 GACACAACTATATTGAAATTAGG - Intergenic
1083070517 11:59975097-59975119 TTTGCATCAATAATGAAATTTGG + Intergenic
1083135187 11:60667005-60667027 TATACAACAACATTGAAATTAGG + Intergenic
1083135204 11:60667266-60667288 GATACAACAACATTGAAATTAGG + Intergenic
1083166989 11:60895786-60895808 GACACAACAATATTGAAACTAGG - Intronic
1083980842 11:66167550-66167572 AATCCAACTATATTAAAATTAGG - Intronic
1084011679 11:66353690-66353712 AACACAAAAATATTGAAATTAGG + Intronic
1084137721 11:67199239-67199261 GACACAACAATATTGAAATTAGG + Intronic
1084369239 11:68728054-68728076 GACACAACAATATTGAAATTAGG + Intronic
1084662607 11:70555227-70555249 GACACAACACTATTGAAATGGGG + Intronic
1084668177 11:70588166-70588188 GACACAACAATATAGAAATTAGG + Intronic
1084738884 11:71125141-71125163 GACACAATAATATTGAAATTAGG + Intronic
1084761492 11:71274838-71274860 GACACAGCAGTATTGAAATTAGG + Intergenic
1085234051 11:74998058-74998080 AATGCAACAACATTGAAATTAGG - Intronic
1085367166 11:75959861-75959883 GACACAACAATAATGAAATTAGG - Intronic
1085441195 11:76564502-76564524 GACACAACAATATTGAAATTAGG - Intergenic
1085599806 11:77845330-77845352 GAATCAACAAAATTGAAAATAGG - Intronic
1086040550 11:82472181-82472203 GAAGCAACAGTATTGAGATGTGG - Intergenic
1086081954 11:82912879-82912901 GACACAACAATATTGAAATTAGG - Intronic
1086273359 11:85094986-85095008 GACACAACAATATTGAAATTAGG - Intronic
1086318620 11:85620339-85620361 GACACAACAATATTAAAGTTAGG + Intronic
1086323559 11:85675364-85675386 GACACAACAATATTGTAATTAGG - Intronic
1086471597 11:87119235-87119257 GACACAACAATATTGAAATTAGG - Intronic
1086552174 11:88065351-88065373 GAAGCGACTATATTAAAATTGGG - Intergenic
1086617769 11:88843561-88843583 GACACAACAGTATTGAAATTAGG + Intronic
1086620039 11:88876682-88876704 GACAGAACAATATTGAAGTTAGG - Intronic
1086646968 11:89234619-89234641 GACACAAAAATATTGAGATTGGG - Intronic
1086655649 11:89350871-89350893 GACAAAACAATATTGAATTTAGG + Intronic
1087064580 11:94015463-94015485 GACACAACAATGTCGAAATTAGG + Intergenic
1087421946 11:97940167-97940189 GACACAGCAATACTGAAATTAGG + Intergenic
1087553264 11:99679650-99679672 GAGACAACACTATTGAAATTAGG + Intronic
1087636009 11:100702225-100702247 GACACAACAATATTAAAATTAGG - Intronic
1087665705 11:101045011-101045033 GATACAACAATATTGGAATTAGG - Intronic
1087671212 11:101109162-101109184 GTCACAACAATATTGAAATCAGG + Intronic
1088223414 11:107591965-107591987 GATGCTCCAATATTGAAGTGCGG - Intronic
1088389469 11:109298322-109298344 GACTCAACAACTTTGAAATTAGG - Intergenic
1088393029 11:109336268-109336290 CTTGCACCAATATTGACATTAGG - Intergenic
1088462835 11:110100785-110100807 GACACAATAATATTGAAATTAGG + Intronic
1089415262 11:118283813-118283835 GACACAGCAATATTGAAATCAGG + Intergenic
1089724355 11:120462218-120462240 GACACAACAATATTGAATTTGGG - Intronic
1090147795 11:124345138-124345160 GACACAGCAACATTGAAATTAGG + Intergenic
1090218208 11:124990158-124990180 GACACAACAATATTGAAATTAGG - Intronic
1090260912 11:125319185-125319207 GGCACAACAATATTAAAATTAGG - Intronic
1090468924 11:126961124-126961146 GACACAACTATATTGAAATTAGG + Intronic
1090818642 11:130320408-130320430 GACACAACAATATTGGAATTAGG - Intergenic
1091110073 11:132957908-132957930 GACACAAAAATATTTAAATTAGG + Intronic
1091869804 12:3879686-3879708 GACACAACAATATTGAAAGTAGG - Intergenic
1092382165 12:8005694-8005716 GAGACTATAATATTGAAATTAGG + Intergenic
1092464985 12:8723245-8723267 GTGACAACAATATTGAAATTAGG - Intronic
1092823993 12:12379996-12380018 AATACAATAATATTGAAATCAGG - Intronic
1093093018 12:14942392-14942414 GATGCATCAATAAGGAAATGTGG + Exonic
1093305372 12:17510904-17510926 GTTGCACCAATTTTGAAATTTGG + Intergenic
1093375031 12:18415500-18415522 GACCCTACAATATTGAAACTAGG + Intronic
1093402043 12:18758108-18758130 GACAAAACAATATTGAAATTGGG + Intergenic
1093450943 12:19312980-19313002 GACACAACAATATTGAAATCAGG - Intronic
1093575166 12:20719315-20719337 GACACAATAATATTGAAATTAGG + Intronic
1093622808 12:21312664-21312686 GATACAAAAATATTGAAATTAGG - Intronic
1093662083 12:21768454-21768476 GACACAGCACTATTGAAATTAGG + Intronic
1093687013 12:22068356-22068378 GACACAACAATATTGAAATTAGG - Intronic
1093691151 12:22110692-22110714 GACACAACAATATTGAAATTAGG - Intronic
1093746417 12:22746633-22746655 AATGCAACAAAATTTAAAATAGG - Intergenic
1093883747 12:24436103-24436125 AATGCAACAATATTGAAGTTAGG + Intergenic
1094059231 12:26295856-26295878 GACACAAAAATATTGAAATTAGG - Intronic
1094205361 12:27833920-27833942 GATACAACGATACTGAAATTAGG + Intergenic
1094280102 12:28727519-28727541 GACACAATAATATCGAAATTAGG - Intergenic
1094635537 12:32223823-32223845 CATAAGACAATATTGAAATTAGG - Intronic
1094637039 12:32236519-32236541 GACACAACAATATTGAAATTAGG + Intronic
1095284749 12:40395656-40395678 GACACAATAATATTGAAATTAGG - Intronic
1095308410 12:40664742-40664764 GATACAACAATATTAAAATTAGG + Intergenic
1095435501 12:42183231-42183253 GACACAATAATATTAAAATTTGG + Intronic
1095518413 12:43033256-43033278 GACACAACAATATTGGAATTAGG - Intergenic
1095605980 12:44068500-44068522 GACACAACAATAGTGAAATTAGG - Intronic
1095657843 12:44691480-44691502 GATACAACGATATTGAAATTAGG + Intronic
1095719388 12:45384540-45384562 GATGCAACAGTAGTGAAATTAGG - Intronic
1095729043 12:45485584-45485606 TACACAACAATATTGACATTAGG + Intergenic
1095754583 12:45750184-45750206 GACACAACTATATTGAAATTAGG - Intronic
1095764161 12:45876164-45876186 CATTCAACAATAATGAAATTAGG - Intronic
1095791220 12:46169535-46169557 GACCCAACAATACTGAAATTAGG - Intergenic
1095881782 12:47144857-47144879 GACATAACAATATTGAAATTAGG + Intronic
1095910558 12:47422302-47422324 GACACAACTATATTGAAATTAGG + Intergenic
1095922891 12:47548586-47548608 GACACAACAATATTGAAATTAGG - Intergenic
1095936860 12:47693203-47693225 GACACAACAGTATTGAAATTAGG - Intronic
1096044741 12:48552640-48552662 GATGCACCAAAGTTGAAATGAGG - Intergenic
1096440335 12:51637244-51637266 GACACAACAATATTGAAATTAGG + Intronic
1096659822 12:53117405-53117427 GATACAACGATATTGAAATTAGG - Intronic
1096906238 12:54938604-54938626 AACACAACAATATTGAAATTAGG + Intergenic
1097163341 12:57066566-57066588 GAAACAGCAATATTGAAACTAGG - Intronic
1097206524 12:57326183-57326205 GATGTAACAATATTGAAATTAGG + Intronic
1097453296 12:59763973-59763995 GATACAACAGTATTGAAATTAGG + Intronic
1097550033 12:61056118-61056140 GACACAGCAATATTGAAATTAGG + Intergenic
1097672025 12:62551316-62551338 GATACAACAACAGTGAAATTAGG - Intronic
1097754505 12:63394342-63394364 CTTGGAACAATATTGACATTTGG + Intergenic
1097758468 12:63433877-63433899 GATACAACAATATTGACATTTGG + Intergenic
1097954735 12:65472015-65472037 GACACAACAATATTGAAATTAGG + Intronic
1098075190 12:66722311-66722333 GACACAACAATATTGAAATTAGG - Intronic
1098206645 12:68117945-68117967 GACACAACAATATTGAAAGCAGG - Intergenic
1098427381 12:70380170-70380192 AACAAAACAATATTGAAATTAGG - Intronic
1098575790 12:72040723-72040745 GACAAAACAATATTGAAATTAGG - Intronic
1098577869 12:72064399-72064421 GATACAACAATATTGAAATTGGG + Intronic
1098626885 12:72682576-72682598 GATGTAATCAAATTGAAATTAGG + Intergenic
1098681452 12:73360811-73360833 GAGGCAAAAATATTGTAAATAGG + Intergenic
1098712800 12:73786994-73787016 AGCACAACAATATTGAAATTAGG - Intergenic
1098752073 12:74306306-74306328 GACACAACAATATTGAAAGTAGG - Intergenic
1098800717 12:74953862-74953884 GACACAACAATGTTGAAATTAGG - Intergenic
1098890036 12:76000841-76000863 GACACTAAAATATTGAAATTAGG - Intergenic
1099052310 12:77794943-77794965 GACACAACCGTATTGAAATTAGG + Intergenic
1099119196 12:78666492-78666514 GACACAATAATATTAAAATTAGG - Intergenic
1099162010 12:79253553-79253575 GACACAACAATATTGAAATTAGG + Intronic
1099474238 12:83088554-83088576 GACACAACAATATTGAAATTAGG - Intronic
1099592414 12:84611630-84611652 GACACAATAATATTGAAATTAGG + Intergenic
1099745681 12:86701579-86701601 CATACAACAATATTGAAATTAGG + Intronic
1100050199 12:90439390-90439412 AATACAACAATATTAAAGTTAGG + Intergenic
1100117487 12:91325112-91325134 GACACAACAATATTGAAATTAGG - Intergenic
1100169092 12:91952602-91952624 GACACAACAATATGGAAATTAGG - Intergenic
1100169238 12:91954703-91954725 GACACAACAATACGGAAATTAGG + Intergenic
1100256997 12:92894279-92894301 GACACAACCATATTAAAATTAGG + Intronic
1100468278 12:94868163-94868185 GACACAACAATATGGAAATTAGG + Intergenic
1100516430 12:95332738-95332760 GACACAACAATATTGAAATTAGG - Intergenic
1100618738 12:96251385-96251407 AACACAACAATTTTGAAATTAGG + Intronic
1100723471 12:97384033-97384055 GACACAACGATATTGAAATTAGG - Intergenic
1100831144 12:98517228-98517250 GGTGCATCAGTATTGCAATTTGG + Intronic
1100922878 12:99509196-99509218 GACACAACAATATTGAAATTAGG + Intronic
1100948748 12:99821057-99821079 GATGCTACAGTTCTGAAATTGGG - Intronic
1100961924 12:99972153-99972175 GATACAACAATATTAAAATTAGG + Intronic
1101084473 12:101221709-101221731 TATGCAAAAAAGTTGAAATTTGG - Intergenic
1101267688 12:103106979-103107001 GATGCAGCATTATTGATGTTAGG + Intergenic
1101275847 12:103199984-103200006 GATGCAAACACATTGAAATCAGG + Intergenic
1101276252 12:103204866-103204888 GATGTATCAATATTGTAAATAGG - Intergenic
1101312305 12:103593153-103593175 TATCCAAAAAAATTGAAATTAGG - Intronic
1101483170 12:105122889-105122911 GACACAACCATATTGAAATTAGG + Intronic
1101620577 12:106383511-106383533 GACACAACAATAGTGAAATTAGG - Intronic
1101685042 12:107010915-107010937 GAGACAACAATATTGAAATTAGG + Intronic
1101886962 12:108672982-108673004 GACATAACAACATTGAAATTAGG + Intronic
1102273961 12:111565684-111565706 GATATAACAATATTGAAATTAGG + Intronic
1102654048 12:114465286-114465308 GACAAAACAATATTGAAATTAGG + Intergenic
1104113624 12:125727397-125727419 GACACATCAGTATTGAAATTAGG + Intergenic
1104277077 12:127339251-127339273 GATGCAATACCAGTGAAATTTGG - Intergenic
1104395730 12:128430905-128430927 GATGTAACAATATTGAAATTAGG + Intronic
1104525717 12:129519471-129519493 AATGCAGCTATATTGAAATGCGG - Intronic
1104991929 12:132629959-132629981 GACACAACACTATAGAAATTAGG - Intronic
1105325041 13:19363217-19363239 GATACAGCAATACTGAAATTAGG - Intergenic
1105337707 13:19489003-19489025 GTCACAACAATATTGAAAGTAGG - Intronic
1105393014 13:19999543-19999565 GACACAGCAATATTTAAATTAGG + Intronic
1105547635 13:21362676-21362698 GACACAACAATATTGAAATTAGG + Intergenic
1105589648 13:21779505-21779527 GATACAACAATATTGAAATGAGG + Intergenic
1105747004 13:23386820-23386842 GACACAACAGTATTGAAATTAGG - Intronic
1105833540 13:24187821-24187843 GACAGAACAATATTGAAAGTAGG + Intronic
1105868242 13:24480330-24480352 GATACAACAATATTGAAATTAGG + Intronic
1106071657 13:26417721-26417743 GATATGACAATTTTGAAATTGGG + Intergenic
1106149262 13:27082727-27082749 GACACAACAATATTGAAATTAGG - Intronic
1106379245 13:29220513-29220535 GGCACAACAATATTGAAATTAGG - Intronic
1106941235 13:34782094-34782116 GACACAACAATATTGAAATTGGG + Intergenic
1106946670 13:34835336-34835358 GATACAATAATATTGAATTTAGG + Intergenic
1107068746 13:36246113-36246135 GACACAACACTATTGAAATTAGG + Intronic
1107194216 13:37628332-37628354 GACACAACTATATTGAAAATAGG + Intergenic
1107459089 13:40584029-40584051 GACAAAACAATATTGAGATTAGG - Intronic
1107689601 13:42939489-42939511 GACACAACAATACTGAAATTAGG - Intronic
1108010342 13:46000897-46000919 GACACAACAATATTGAAATTAGG - Intronic
1108278051 13:48831361-48831383 GACACCACAATATTGAAATTAGG + Intergenic
1108331137 13:49385676-49385698 GATACAACAATACTGAAATTAGG - Intronic
1108602038 13:52003302-52003324 GACACAACAATATTAAAATTAGG - Intronic
1108632999 13:52304373-52304395 GACACAACAATATTGAAAGTAGG - Intergenic
1108653692 13:52508182-52508204 GACACAACAATATTGAAAGTAGG + Intergenic
1108909253 13:55522476-55522498 TATATAACAATATTAAAATTAGG - Intergenic
1108916663 13:55622372-55622394 GACAAAACAATATTGAAATTAGG + Intergenic
1109080512 13:57893845-57893867 GACACAACAGTATTGAAGTTTGG + Intergenic
1109508956 13:63343254-63343276 GAAACAATAATACTGAAATTAGG - Intergenic
1109515469 13:63438308-63438330 GGTACAACACTATTGAAATTGGG - Intergenic
1109533131 13:63679450-63679472 TTTGCAACAATAGTGAAACTTGG - Intergenic
1109556651 13:63984797-63984819 CATACAACAATATTGAAATTAGG - Intergenic
1109815624 13:67579420-67579442 GACACAGCAATATGGAAATTAGG - Intergenic
1109953265 13:69530533-69530555 GACACAACAATACTGAAATTAGG + Intergenic
1110282434 13:73710740-73710762 GACACAACAATATTGAAATTAGG + Intronic
1110382505 13:74869991-74870013 GACACAACAATATTGAATTTAGG - Intergenic
1110447256 13:75599749-75599771 GACACAATAATATTGAAATGAGG + Intronic
1110521590 13:76485458-76485480 GACACAATAATATTGAAATTAGG + Intergenic
1110766506 13:79285190-79285212 GAAATAACAATATTGAATTTAGG + Intergenic
1110829553 13:80014593-80014615 GACACAACAATATTGAAATTAGG + Intergenic
1110995806 13:82107929-82107951 TACACAACAATATTGAAGTTGGG - Intergenic
1111055655 13:82946460-82946482 GAGGCAAAAACTTTGAAATTTGG + Intergenic
1111065245 13:83082577-83082599 GACCCAAAAATATTAAAATTAGG - Intergenic
1111384433 13:87505653-87505675 AACACAACAATATTAAAATTAGG - Intergenic
1111571720 13:90096693-90096715 GACACAACAATAGTGAAATCAGG - Intergenic
1111617626 13:90681267-90681289 GATACACTAATATTGAAATTAGG - Intergenic
1111640528 13:90963893-90963915 GACACAACAATATTGAAATTAGG + Intergenic
1111787392 13:92806631-92806653 GACACAACAATACTGAAAATAGG - Intronic
1111970657 13:94911633-94911655 GATACAAATATATAGAAATTAGG - Intergenic
1112116177 13:96357455-96357477 GACACAACAATATTGAAATTAGG - Intronic
1112521158 13:100096463-100096485 GATACAACAATATTGAAATTAGG + Intronic
1112623072 13:101071927-101071949 GACACAACAATATTGACATTAGG - Intronic
1112856688 13:103779525-103779547 GATACAACAATATTGAAATTAGG - Intergenic
1112939488 13:104844145-104844167 GACACAATAATATTGAAATTAGG - Intergenic
1113353402 13:109552704-109552726 GAAGGAAGTATATTGAAATTGGG + Intergenic
1113487023 13:110661761-110661783 GACACAACATTATTGAAATTAGG - Intronic
1113695039 13:112339274-112339296 GACACAACAATATTGAAATTAGG + Intergenic
1113722708 13:112572583-112572605 GTCACAACAATATTGAAATTAGG - Intronic
1113979187 13:114258610-114258632 GATTCATCAATATTGAAGTCAGG - Intronic
1114042982 14:18695946-18695968 TACACAACAGTATTGAAATTAGG - Intergenic
1114047273 14:18886386-18886408 TACACAACAATATTGAAATTAGG - Intergenic
1114116941 14:19633011-19633033 TACACAACAATATTGAAATTAGG + Intergenic
1114152450 14:20059047-20059069 GATACAACAATATTGGATTTAGG - Intergenic
1114368592 14:22058726-22058748 GACATAACAATATTGAAAATTGG + Intergenic
1114709669 14:24765771-24765793 GAATCAAAAATAGTGAAATTAGG + Intergenic
1114734292 14:25027582-25027604 GACACAACAATATTGAAATTAGG + Intronic
1114890878 14:26921409-26921431 GATGCAGCGATACTGAAATTCGG + Intergenic
1114977293 14:28117793-28117815 GAGACAACAATATTGAAATCAGG + Intergenic
1115043706 14:28962723-28962745 AAAACAACAATATTGAAATTAGG - Intergenic
1115060606 14:29184714-29184736 GAAACAATAATATTGAAATTAGG - Intergenic
1115101361 14:29704604-29704626 ATTGAAACAACATTGAAATTGGG - Intronic
1115280496 14:31656535-31656557 CAGACAACAATATTGAAATCAGG - Intronic
1115308243 14:31953861-31953883 GACACAACAATATTGAAATTAGG + Intergenic
1115379143 14:32714055-32714077 GACACAACAATATTGAAATGCGG - Intronic
1115468585 14:33744279-33744301 GACATAACAATATTGAAATTAGG - Intronic
1115486811 14:33918333-33918355 GACACAACAATCTTGCAATTAGG + Intergenic
1115542086 14:34430441-34430463 GACATAACACTATTGAAATTAGG + Intronic
1115622050 14:35150273-35150295 GACACAACAATACTGAAATTAGG - Intronic
1115709541 14:36035695-36035717 GACACAGTAATATTGAAATTAGG + Intergenic
1115803026 14:37017289-37017311 GACACAACAATATTAAAATTAGG - Intronic
1115891547 14:38035394-38035416 GACATAACAATGTTGAAATTAGG - Intronic
1116016578 14:39414942-39414964 GAGATAATAATATTGAAATTAGG - Intronic
1116034638 14:39613009-39613031 CATTAAACAGTATTGAAATTGGG + Intergenic
1116091669 14:40315605-40315627 GACACAACATTACTGAAATTAGG + Intergenic
1116101246 14:40439714-40439736 GACACAATAATATTGAAATTAGG - Intergenic
1116159059 14:41243892-41243914 AAAGCAACAATATCAAAATTAGG - Intergenic
1116387947 14:44355882-44355904 GACAAAACAATATTGAAATTAGG - Intergenic
1116401162 14:44508986-44509008 GACACAACAATATTGAAATTAGG + Intergenic
1116499457 14:45602636-45602658 AACACAACACTATTGAAATTAGG - Intergenic
1116604893 14:46979326-46979348 GACACAACAGTGTTGAAATTAGG + Intronic
1116607172 14:47015035-47015057 GACACAACAATATTACAATTAGG - Intronic
1116828774 14:49697238-49697260 GATACAACAATATTGAAAGTAGG - Intronic
1116839855 14:49809154-49809176 GATTCAACAATATTGATGTTTGG + Intronic
1116924899 14:50624554-50624576 GGCACAACAATATTGAAAATAGG + Intronic
1117169250 14:53075066-53075088 GACACAACAATATTGAGATTAGG + Intronic
1117201694 14:53396267-53396289 GACACAGCAATATTGAAATTAGG + Intergenic
1117269588 14:54128521-54128543 GACACAACAATATTAAAATTAGG + Intergenic
1117296293 14:54382654-54382676 CAAGAAACAATATTGAAATTAGG + Intergenic
1117401447 14:55362164-55362186 GACACAACAATATTGAAATCGGG - Intergenic
1117519553 14:56537134-56537156 GACACAGCAATATTGAAATTAGG + Intronic
1117764481 14:59066772-59066794 AACACAACAGTATTGAAATTAGG - Intergenic
1117801733 14:59450520-59450542 GAAACAAACATATTGAAATTAGG - Intronic
1117827489 14:59718785-59718807 GATGCAAAAATATTTACAATGGG - Intronic
1117887027 14:60375109-60375131 GAAACAACAATATTGAAATGAGG + Intergenic
1117926780 14:60789149-60789171 GACACAACAATATTTAAATTAGG - Intronic
1117932321 14:60855972-60855994 GACACAACAATATTTAAAATAGG + Intronic
1117935412 14:60900109-60900131 GATGCAGCAATATTGAAATTAGG + Intronic
1118037927 14:61888425-61888447 GACACAACATTATTGAAATTAGG - Intergenic
1118045257 14:61963137-61963159 GACACAACAATATTAAAATTAGG + Intergenic
1118116791 14:62786960-62786982 GACACAATAATATCGAAATTAGG + Intronic
1118125011 14:62891972-62891994 GACACAACAATATTGAAATTAGG + Intronic
1118176702 14:63447845-63447867 GACACAACAGTATTGAAATTAGG - Intronic
1118507729 14:66432482-66432504 GACACAACAATATCGAAATCAGG + Intergenic
1118527026 14:66656850-66656872 GACACATCAATACTGAAATTAGG + Intronic
1118553155 14:66979890-66979912 GACATAATAATATTGAAATTAGG - Intronic
1118662609 14:68030882-68030904 GACACAACAATATTGAAATCAGG - Intronic
1118692995 14:68357986-68358008 GACACGACAACATTGAAATTAGG - Intronic
1118927968 14:70211200-70211222 CACACAACAATATTGAAATTAGG - Intergenic
1119017274 14:71071876-71071898 GACATAGCAATATTGAAATTTGG - Intronic
1119091588 14:71787124-71787146 ACAACAACAATATTGAAATTAGG + Intergenic
1119879256 14:78087193-78087215 GATGCAAATATATTAAAATGTGG - Intergenic
1119883366 14:78119889-78119911 GACACAACAATATTGAAATTAGG - Intergenic
1119944353 14:78676096-78676118 GATACAATAATATTGACATTAGG + Intronic
1119964234 14:78895779-78895801 GACACAATAATATAGAAATTAGG - Intronic
1120023793 14:79559380-79559402 GACACAACAATATTGAATGTAGG - Intronic
1120084493 14:80254669-80254691 GACACAAGAATATTAAAATTAGG + Intronic
1120175003 14:81284150-81284172 GACAAAGCAATATTGAAATTAGG + Intronic
1120264701 14:82234033-82234055 GATACAGCCATATTGAAATTAGG + Intergenic
1120301740 14:82715952-82715974 GGTGCAAAAATATTCACATTTGG - Intergenic
1120430661 14:84410237-84410259 GACATAACAATATTCAAATTAGG + Intergenic
1120482050 14:85062445-85062467 GACATAGCAATATTGAAATTAGG + Intergenic
1121165585 14:91793766-91793788 GACACAACAATATTGAAATTAGG + Intronic
1121296254 14:92827539-92827561 GACACAGCAATATTGAAATTAGG + Intronic
1121461472 14:94081867-94081889 GACACAACAGTGTTGAAATTAGG + Intronic
1121910392 14:97785390-97785412 GACACAACAATATTAAAATTAGG + Intergenic
1121998011 14:98620448-98620470 GATACAAAAATATTGAAATCAGG + Intergenic
1122001383 14:98658136-98658158 GACACAACAATATTGAAATTAGG + Intergenic
1122054538 14:99084645-99084667 GACACAACAACATTGAAATTAGG - Intergenic
1122170408 14:99869476-99869498 GACACAACAATATTGAAATAAGG + Intronic
1122678482 14:103437170-103437192 GAAGCAACAATACTGAAAGCCGG - Intronic
1123013813 14:105363887-105363909 GACACAATAATATGGAAATTAGG - Intronic
1123027036 14:105430280-105430302 GACACAACAATACTGAAATTGGG - Intronic
1123175583 14:106414976-106414998 GATGCAATAAAAGTTAAATTTGG + Intergenic
1123801025 15:23820935-23820957 GACACAACAATATTAAAGTTTGG - Intergenic
1124036570 15:26058397-26058419 GACTCAACAGTATTGAAATTAGG + Intergenic
1124461028 15:29891839-29891861 GATACAACATTATTGAAATTAGG + Intronic
1124950345 15:34313045-34313067 GACACAACAATACTGAAATTAGG + Intronic
1125000549 15:34765613-34765635 GATACAAGAATATTGAAATTCGG - Intergenic
1125236741 15:37523640-37523662 GACACAACAGTATTGAAATTAGG - Intergenic
1125252765 15:37724831-37724853 GACACAACAATATTGAAGTTAGG - Intergenic
1125367491 15:38933529-38933551 AAAACAATAATATTGAAATTAGG - Intergenic
1125822743 15:42646904-42646926 GACACAACAATATTGAAATGAGG - Intronic
1125875356 15:43139352-43139374 GACACAACAATATTAAAATTAGG + Intronic
1126391708 15:48162903-48162925 GACACAATAATATTGAAATTAGG + Intronic
1126828241 15:52572311-52572333 GACACAACGATATTGAAATTAGG + Intergenic
1126885998 15:53150709-53150731 ACTTCAACAACATTGAAATTTGG + Intergenic
1126971623 15:54119531-54119553 GACACAACAATATTGAAATTAGG + Intronic
1127025456 15:54800283-54800305 GACACAACAATATTGTAATTAGG + Intergenic
1127206212 15:56722044-56722066 GACATAGCAATATTGAAATTAGG - Intronic
1127447118 15:59074916-59074938 GACACAACAACATTGAAATTAGG - Intronic
1127724869 15:61739794-61739816 GACACAACAATATTGAAATTAGG - Intergenic
1127948594 15:63781617-63781639 GACACAACAATATTGAAATTAGG + Intronic
1128189939 15:65682806-65682828 GACACAACAATATTGAAATTAGG - Intronic
1129049182 15:72764048-72764070 GACATAACAATATTGAAATTAGG + Intronic
1129289804 15:74556217-74556239 GACACAACCATACTGAAATTAGG - Intronic
1129289951 15:74557690-74557712 GACACAACCATATTGAAATTAGG - Intronic
1129819092 15:78584440-78584462 GATGCAACAAAAATGAACTGAGG - Intronic
1129918905 15:79301657-79301679 TATGAAACAAAAATGAAATTGGG + Intergenic
1130129820 15:81130797-81130819 GACACAACAATATATAAATTAGG - Intronic
1130290426 15:82594818-82594840 CACACAACAAAATTGAAATTAGG - Intronic
1130408141 15:83621385-83621407 GATACAACAATATTGAAATTAGG - Intergenic
1130626677 15:85522859-85522881 GATGGAAAAATACTGAAATGTGG - Intronic
1131042804 15:89287735-89287757 GACAAAACAATATTGAAATTAGG - Intronic
1131219065 15:90565872-90565894 GAGATAACAATATTGAAATTAGG + Intronic
1131626045 15:94121971-94121993 GACATAACAATATTGGAATTAGG + Intergenic
1131642705 15:94309712-94309734 AATGCAAATATATTAAAATTCGG - Intronic
1131756564 15:95570015-95570037 GATACACCAATACTGAAATTAGG - Intergenic
1131909937 15:97187267-97187289 GGCACAACAATAGTGAAATTAGG - Intergenic
1132032402 15:98449520-98449542 GACACAACAATATTGAAATTAGG - Intronic
1132420977 15:101668300-101668322 GACACAATAACATTGAAATTAGG - Intronic
1133506203 16:6414933-6414955 GACTCAACAGTATTGATATTGGG - Intronic
1134246261 16:12542426-12542448 GAGGAAACAAAATTGAACTTGGG - Intronic
1135506647 16:23043351-23043373 GACACAACAATATTGAAATTAGG - Intergenic
1135515274 16:23127078-23127100 GATGCAACAAAATCAAATTTAGG + Intronic
1135819508 16:25670010-25670032 GACACTACAGTATTGAAATTAGG + Intergenic
1137022585 16:35443310-35443332 GACACAACAATATTAAAATTGGG + Intergenic
1137234118 16:46599353-46599375 GACACAGCAATATTGAAATTAGG - Intronic
1137416174 16:48282741-48282763 GACACAGCAATATTGAAATTAGG + Intronic
1137465837 16:48708237-48708259 GACAAAACAATATTGAAATTAGG + Intergenic
1138255465 16:55554838-55554860 GACACAGCAATACTGAAATTAGG - Intronic
1138836025 16:60435620-60435642 TAAGACACAATATTGAAATTAGG + Intergenic
1138972024 16:62156720-62156742 GATGAAACAATTTTAAAAATGGG + Intergenic
1139082074 16:63534544-63534566 AACACAACAGTATTGAAATTAGG - Intergenic
1140162618 16:72513753-72513775 GATACAACAGTATTCAAATTAGG - Intergenic
1140398975 16:74654534-74654556 GACAAAACAATACTGAAATTAGG + Intronic
1140493159 16:75358003-75358025 GACAAAACAATATTGAAATTAGG - Intronic
1140549106 16:75844753-75844775 GACACAACAATATTGAAATTAGG - Intergenic
1140872291 16:79118201-79118223 GACACAACAGTATTGAAATTAGG - Intronic
1141821207 16:86447275-86447297 GAGGCAACAAGGTTGAAATCAGG - Intergenic
1141998637 16:87650408-87650430 GACACAACAGTATTAAAATTAGG + Intronic
1142908758 17:3069067-3069089 GACATATCAATATTGAAATTAGG - Intergenic
1142919006 17:3168134-3168156 GACACAACAATATTGAAATTAGG - Intergenic
1144165662 17:12608005-12608027 GGCACAACAATATTGAAATTAGG - Intergenic
1144265678 17:13566411-13566433 GACACAACAATATTGAAATTAGG + Intronic
1144530785 17:16037083-16037105 CACACAACAATATTCAAATTCGG - Intronic
1144706827 17:17374077-17374099 GACACAACAATATCGAAATTAGG + Intergenic
1145277718 17:21444488-21444510 GATGCAGCAATATTGAAATTAGG - Intergenic
1145713985 17:27002305-27002327 GATGCAGCAATATTGAAATTAGG - Intergenic
1146042966 17:29474506-29474528 GACACAATAATGTTGAAATTAGG - Intronic
1146106011 17:30037890-30037912 GATACAACAATATTAAAATTAGG + Intronic
1146115491 17:30134089-30134111 GACGCAACAATACTGAAATTAGG - Intronic
1146158380 17:30543903-30543925 GACACAACAATATTGAAATCTGG + Intergenic
1146312230 17:31778244-31778266 AATTCAACAATTCTGAAATTGGG + Intergenic
1146412695 17:32601323-32601345 GATACAACAAGATTGAAATTAGG - Intronic
1146538744 17:33676219-33676241 GACACAACAATATTAAAATTAGG + Intronic
1146578760 17:34017395-34017417 CACCCAACAATATTGAAATTAGG + Intronic
1147027930 17:37604818-37604840 GACATAACAGTATTGAAATTAGG - Intronic
1147125736 17:38366884-38366906 GATGTAATAAAATTGAATTTGGG + Intronic
1147554930 17:41472282-41472304 GACACAGCAATATTGAAATTAGG - Intergenic
1148254998 17:46122935-46122957 AACACAACAATATTGAAATTAGG + Intronic
1148377033 17:47157772-47157794 GATGCAACAATGCTGAAAAATGG + Intronic
1148660272 17:49325257-49325279 GATACAACAATATTGAAATTAGG - Intronic
1149299422 17:55290632-55290654 GACACAACAATATTGAAAGTAGG + Intronic
1149378096 17:56065605-56065627 GACACAACAATATTGAAATTAGG - Intergenic
1149726001 17:58895270-58895292 GACACAACACTATTGAAATTAGG + Intronic
1149972063 17:61228773-61228795 GCCACAATAATATTGAAATTGGG + Intronic
1150031592 17:61742565-61742587 GACACAACAATACTGAAATTAGG - Intronic
1150055990 17:62016646-62016668 GATGAAACATTAGTGATATTTGG - Intronic
1150262932 17:63811284-63811306 GATGCAACATGCTTGAGATTGGG + Intronic
1150662631 17:67097063-67097085 GACACAACAGTATTGAAATCAGG - Intronic
1150833943 17:68548012-68548034 GACACAACAATATTGAAATGAGG - Intronic
1150866686 17:68857954-68857976 GACACAACAATATTGGGATTAGG + Intergenic
1150947993 17:69767895-69767917 GACACAACAATATTGAAATTAGG + Intergenic
1151027433 17:70694988-70695010 AATAAAACAATATTGAAATTTGG + Intergenic
1151410764 17:73926661-73926683 GACACAAAAATATTGAAATTAGG + Intergenic
1151859061 17:76745713-76745735 GACACAGCAATATTGAAATTAGG + Intronic
1151949340 17:77341306-77341328 GACTCAACAATATTGAAATTAGG - Intronic
1151950490 17:77350864-77350886 CATGAAACAAGATTGAATTTTGG - Intronic
1152194247 17:78907358-78907380 GACACAACAATATTGAAATTAGG - Intronic
1152402175 17:80073618-80073640 GACTCAACAGTATTGAAATTAGG + Intronic
1152979003 18:255140-255162 GACGAGACAATATTGAATTTAGG + Intronic
1153144151 18:2010196-2010218 GACACAACAATATTGAAATGAGG - Intergenic
1153270626 18:3317824-3317846 GGCACAACAATTTTGAAATTAGG - Intergenic
1153406498 18:4746713-4746735 GATACAACAATATTGAAATTAGG - Intergenic
1153566408 18:6422687-6422709 GACACAACAATATAGAAATTAGG - Intergenic
1153569901 18:6459741-6459763 GACACAATAATATTGCAATTAGG + Intergenic
1153696513 18:7648319-7648341 GACTCAACAATATTAAAATTAGG + Intronic
1153871737 18:9327382-9327404 GACACAACAATATTGAAATTAGG + Intergenic
1153896334 18:9565332-9565354 GACTCAACAATATTAAAATTGGG + Intronic
1154127806 18:11708289-11708311 GACATAACAGTATTGAAATTAGG - Intronic
1154249498 18:12731769-12731791 GATACAACAATATTGAAATGAGG - Intergenic
1154341656 18:13507793-13507815 GACACAAGAATATTGAAATTAGG + Intronic
1154370621 18:13758898-13758920 GATACAACAATATTGAAATAAGG - Intronic
1154953203 18:21229948-21229970 GACACAATAAGATTGAAATTAGG - Intergenic
1155137628 18:23011892-23011914 GACACAACAACATTGAAATTAGG + Intronic
1155511904 18:26586448-26586470 AACACAACAATATTGAAATTAGG + Intronic
1155626388 18:27839765-27839787 GACACAACAATATTGAAATTAGG + Intergenic
1155702423 18:28763667-28763689 CATGTAACAAAATTGAAAATGGG + Intergenic
1155741213 18:29290450-29290472 GACACAATAATATTGAAATTAGG + Intergenic
1155824643 18:30424318-30424340 GACGCAATAATATTAAAATTGGG + Intergenic
1155838541 18:30618784-30618806 GACACAACCATATTGAAATTAGG + Intergenic
1156168456 18:34452974-34452996 GACACAATAATATTGAAATTAGG - Intergenic
1156572236 18:38269645-38269667 GAGATAACAATATTGAAATGAGG - Intergenic
1156635053 18:39017758-39017780 GACACAGCAATATTGAAATTAGG - Intergenic
1156785618 18:40910378-40910400 GACACAACAATACTGAAATTAGG - Intergenic
1156851974 18:41739107-41739129 GACACAGCAATATTGAAAATAGG + Intergenic
1156881006 18:42079240-42079262 GACACAACAATATGGAAATTAGG - Intronic
1156994954 18:43453959-43453981 GATGCAAACATATTGGAACTGGG + Intergenic
1157010230 18:43639364-43639386 GACATAACAATATTGAAATTAGG - Intergenic
1157171218 18:45407710-45407732 GATACAACAGTATTGAAATTAGG - Intronic
1158204620 18:54978806-54978828 GACACAACAATATTGAAAATAGG - Intergenic
1158212058 18:55062637-55062659 GACACAATAAAATTGAAATTAGG - Intergenic
1158446237 18:57524265-57524287 GACACACAAATATTGAAATTAGG + Intergenic
1158582118 18:58692598-58692620 CACACAACAATATTGAAATTAGG + Intronic
1158757334 18:60341666-60341688 GACAGAATAATATTGAAATTAGG + Intergenic
1158816659 18:61105986-61106008 GACACAACAATGTTGAAATTAGG - Intergenic
1158978157 18:62731528-62731550 GACACAACAGTATTGAAATTGGG + Intronic
1159121196 18:64173528-64173550 GACACAATAATATTAAAATTAGG - Intergenic
1159175614 18:64829798-64829820 GACACAAGAACATTGAAATTAGG - Intergenic
1159191223 18:65045362-65045384 GACAAAACAATATTGAAAATAGG + Intergenic
1159198862 18:65156873-65156895 GACACAATAATGTTGAAATTGGG + Intergenic
1159388830 18:67761501-67761523 GACACAACAATATTGCAATTAGG + Intergenic
1159514489 18:69440080-69440102 GAGACAACAATGTTGAAATTAGG - Intronic
1159656867 18:71040326-71040348 GACACAGCAATATTGAAATTAGG + Intergenic
1159695104 18:71547199-71547221 GAAACAACAATGTTGAATTTAGG - Intergenic
1159778094 18:72626904-72626926 GAAGCCAAAATATTGAAATGAGG - Intronic
1159982231 18:74797349-74797371 GTTGCCACTAAATTGAAATTTGG - Intronic
1160097155 18:75884862-75884884 GATGCAACAAGATTGAATTTAGG - Intergenic
1160320563 18:77889688-77889710 CACATAACAATATTGAAATTAGG - Intergenic
1160552074 18:79700143-79700165 GACATAACAGTATTGAAATTAGG + Intronic
1162682419 19:12356057-12356079 AATTCAACTATATTAAAATTAGG + Intronic
1162843765 19:13375356-13375378 GACATAACAATATTGAAATTAGG + Intronic
1164901192 19:31925955-31925977 GACACAGCAATATTGAAATTAGG - Intergenic
1164940165 19:32246022-32246044 GACACAACAATATTGAAAACTGG + Intergenic
1165125021 19:33588266-33588288 GACACAACAATATTGAAGTTAGG + Intergenic
1165644418 19:37422252-37422274 AACACAACAATATTGAAATTAGG - Intronic
1165686550 19:37826189-37826211 GACACAACAATATTGAACGTAGG + Intergenic
1166557703 19:43712353-43712375 GACACAACTATAATGAAATTAGG - Intergenic
1166580172 19:43890156-43890178 AACACAACAATATTGAAATCAGG - Intronic
1167021922 19:46883407-46883429 GACACAACCATGTTGAAATTAGG - Intergenic
1167626845 19:50595956-50595978 GACACAACAGTATTAAAATTAGG + Intergenic
1168652838 19:58103669-58103691 GACAAAACAATATTGAACTTAGG + Intronic
925200458 2:1964117-1964139 GACACAATAATATTGAAATTAGG - Intronic
925726450 2:6877247-6877269 CATGGAACAAAATTGAATTTAGG - Intronic
925871433 2:8274938-8274960 GACACAACGGTATTGAAATTAGG - Intergenic
926387963 2:12356581-12356603 GATACAACAATATTGAAATTTGG - Intergenic
926449988 2:12991253-12991275 GACACAACAATATTGATATTAGG + Intergenic
926608418 2:14921138-14921160 GACACAGCAATACTGAAATTAGG - Intergenic
926649449 2:15325944-15325966 GACACAACAATATTGAAATGAGG - Intronic
926836287 2:17025589-17025611 GACACAAGAATATTGAAGTTAGG - Intergenic
926868664 2:17388367-17388389 AAAGAAACAAAATTGAAATTAGG + Intergenic
926895368 2:17681564-17681586 GACACAGCAATATTGAAATTAGG - Intronic
927299041 2:21489495-21489517 GACACAACAATATTGAAATTAGG - Intergenic
927322535 2:21764167-21764189 GAGACAACAATATTAAAATTAGG - Intergenic
927324616 2:21789889-21789911 GACACAAAAATATTGAAATTAGG - Intergenic
927657318 2:24960379-24960401 GACAAAACAATATTGAAAGTAGG + Intronic
927731336 2:25475021-25475043 GACATAAAAATATTGAAATTAGG + Intronic
927755329 2:25703958-25703980 CATACAACAATATTGAAATTAGG + Intergenic
928046148 2:27934462-27934484 GACACAGCAGTATTGAAATTAGG + Intronic
928264002 2:29794624-29794646 GATACAAAAATATTGAAATTAGG - Intronic
928607548 2:32957411-32957433 GACACAACAATATTGAAATCAGG - Intronic
928631178 2:33193885-33193907 AACACAACAATATTGAAATTAGG + Intronic
928657244 2:33464940-33464962 GACACAACAGTATTAAAATTAGG + Intronic
928792065 2:34969371-34969393 GACACAACAGTATTGAAATGAGG - Intergenic
928818914 2:35336448-35336470 GACACAACATTATGGAAATTAGG + Intergenic
929097605 2:38278802-38278824 GACACAACAACATTGAAATTAGG - Intergenic
929338152 2:40777662-40777684 GATACAACAACATTTAAATCAGG - Intergenic
929473482 2:42220571-42220593 GAGATAACAATATTGAAATGAGG + Intronic
929529755 2:42741563-42741585 GACACAACAATATCAAAATTAGG - Intronic
929672861 2:43891672-43891694 GACACAACAATATTGAAATTAGG + Intronic
930127919 2:47817682-47817704 GACACAACAGTATCGAAATTAGG - Intronic
930315182 2:49788764-49788786 GACACAACATTATTGAAGTTAGG - Intergenic
930831349 2:55746872-55746894 GACACAGTAATATTGAAATTAGG + Intergenic
930948721 2:57110382-57110404 CGCACAACAATATTGAAATTAGG - Intergenic
930991807 2:57665231-57665253 GATGCAACAATAATGAAATTAGG - Intergenic
931022349 2:58062331-58062353 GATACAGCAATTTTGAAATTAGG + Intronic
931279599 2:60777740-60777762 GACACAACAATACTTAAATTAGG - Intronic
931499852 2:62854527-62854549 GACACAACAATATTGAAACTAGG - Intronic
931683889 2:64776431-64776453 GACACAACAATATTAAAATCAGG - Intergenic
931895275 2:66721798-66721820 GACACAACAATACTGAATTTAGG + Intergenic
932033343 2:68213357-68213379 AAGACAACAGTATTGAAATTAGG - Intronic
932052573 2:68413551-68413573 AACACAACAATATTGAAATTAGG + Intergenic
932116771 2:69057656-69057678 GACACAACAATATTGAAATTAGG + Intronic
932186104 2:69697708-69697730 GACACAACAATATTGACATTAGG - Intronic
932469941 2:71948214-71948236 GACACAACAATATTGCAATGAGG - Intergenic
932857383 2:75250574-75250596 GACACAACAATTTTGAAATTAGG - Intergenic
932951020 2:76293701-76293723 GACACAACAATATTGAAATTAGG - Intergenic
932984440 2:76708331-76708353 TATGAAACAATATCAAAATTAGG + Intergenic
933086727 2:78062182-78062204 GCTGCAACCATATTGGCATTGGG - Intergenic
933171018 2:79125274-79125296 AACACAATAATATTGAAATTAGG - Intergenic
933182033 2:79238181-79238203 GACACAACAATATTGAAATTAGG - Intronic
933302028 2:80551993-80552015 GACGCAACAATATTAAAATTAGG - Intronic
933539702 2:83623415-83623437 GAAACAGCAATATTGAAATTAGG - Intergenic
933575956 2:84067917-84067939 GACAAAACAATATGGAAATTTGG + Intergenic
933626715 2:84609450-84609472 GACACAACAATATTGAAATTAGG - Intronic
933630121 2:84646329-84646351 GACATAATAATATTGAAATTAGG + Intronic
933944548 2:87274371-87274393 GACACAACAATATTAAAATTAGG - Intergenic
934061662 2:88299884-88299906 GACACAACAATATTGAAATTAGG + Intergenic
934548304 2:95237528-95237550 GACACAACAGTATTGAAATTAGG + Intronic
934715966 2:96543709-96543731 GGCACAACAATATTGAAACTGGG + Intronic
934869679 2:97851832-97851854 GATACAATAATATTACAATTAGG + Intronic
934881096 2:97979990-97980012 GAGACAACAATATTGAAATTAGG - Intronic
935067737 2:99665345-99665367 GATGGACCAATATTTAATTTTGG + Intronic
935168899 2:100594571-100594593 GACACAGCAATATTGAAATTAGG - Intergenic
935228350 2:101074178-101074200 GACACAAAAATACTGAAATTAGG - Intronic
935289098 2:101594237-101594259 GAAGCAACAATATTGACATTAGG - Intergenic
935344134 2:102089281-102089303 GATGCAACAATATTGAAATTAGG - Intronic
935485550 2:103648780-103648802 GATGCAAAAGTATTGAAATTAGG + Intergenic
935890964 2:107677505-107677527 GATGAAATAATATTGAGATGAGG + Intergenic
935990378 2:108713846-108713868 GAGACAACAATACTGAAATTAGG - Intergenic
936005283 2:108881680-108881702 GACATAACAATACTGAAATTAGG - Intronic
936079870 2:109424802-109424824 GACACAACAATACTGAAATCAGG + Intronic
936335664 2:111587210-111587232 GACACAACAATATTAAAATTAGG + Intergenic
936726549 2:115324878-115324900 GACATAACAATATTGAAATTAGG - Intronic
936828043 2:116605094-116605116 GAATCAGCAATATTAAAATTAGG - Intergenic
936920187 2:117680586-117680608 GATACAACAATATTGAAATTAGG + Intergenic
937461755 2:122094961-122094983 GACACAACAATATTCAAATTAGG - Intergenic
937540553 2:122946893-122946915 GACACAACAATATTGAAATTAGG - Intergenic
937678341 2:124616778-124616800 GATGGAACAATATCAAAATTAGG - Intronic
937767044 2:125673568-125673590 GACACAACACTATTGAAGTTAGG + Intergenic
937830326 2:126413585-126413607 AACACAGCAATATTGAAATTAGG - Intergenic
938022526 2:127917806-127917828 GACACAACAATATGGAAATTAGG - Intergenic
938158637 2:128962673-128962695 GAGACAACAATATTGAAATTAGG + Intergenic
938424652 2:131174932-131174954 TACACAACAGTATTGAAATTAGG - Intronic
938606613 2:132899986-132900008 GACACAACAGTAATGAAATTGGG - Intronic
938678632 2:133665368-133665390 GACACAACAGTATTGAAATTAGG - Intergenic
938872009 2:135488081-135488103 GACAAAACAATATTGAAATTAGG - Intronic
938876941 2:135541514-135541536 GACAAAACAACATTGAAATTAGG - Intronic
938946923 2:136220995-136221017 AAAACAACAATATTGAAATTAGG + Intergenic
938987220 2:136589123-136589145 GACATAACAATATTAAAATTAGG - Intergenic
939035552 2:137126858-137126880 GGAGACACAATATTGAAATTAGG - Intronic
939274294 2:139980351-139980373 GACAAAGCAATATTGAAATTAGG - Intergenic
939284072 2:140106186-140106208 GATACAACAATATCGAAATTAGG + Intergenic
939465571 2:142550956-142550978 TATTCAAGAATATTGAAATCAGG + Intergenic
939486561 2:142819881-142819903 GACACAAGAATGTTGAAATTAGG - Intergenic
939517067 2:143182304-143182326 GATACCACAGTATTAAAATTAGG - Intronic
939640208 2:144631505-144631527 GACACAACAATTTTGAAATTAGG + Intergenic
939653353 2:144791350-144791372 GACACAACATTATTAAAATTAGG - Intergenic
939663678 2:144922530-144922552 AAAAGAACAATATTGAAATTAGG + Intergenic
939722717 2:145675079-145675101 GAGACTACAATAATGAAATTGGG - Intergenic
939786905 2:146525870-146525892 GATACAACAACATTAAAATCGGG + Intergenic
939817396 2:146912500-146912522 AAGACAACAATATTGAAATAAGG + Intergenic
939933658 2:148261883-148261905 GACACAACAATATTCAAATTAGG - Intronic
940049366 2:149446038-149446060 GATACAACAATACTGAAATTAGG - Intronic
940106606 2:150108086-150108108 GATGAAGCAATCTTGAAATCAGG + Intergenic
940399799 2:153235183-153235205 GACATAACAATATTGAAATGAGG + Intergenic
940495976 2:154429099-154429121 AACACAACAATATTGAAGTTAGG + Intronic
940685678 2:156847890-156847912 GACACAGTAATATTGAAATTAGG + Intergenic
940822977 2:158377936-158377958 GACACAACAATATTGAAATTAGG + Intronic
941056445 2:160794996-160795018 GGTACAACACTATTGAAATTAGG + Intergenic
941109800 2:161407021-161407043 GAGGCAAAAATTTTGGAATTTGG - Intronic
941238256 2:163003012-163003034 GACAAAACAATATTGAAATTAGG + Intergenic
941386209 2:164855676-164855698 GACACAACAGTATTGAAATTAGG - Intergenic
941425491 2:165339436-165339458 AATGCATAAATATTGAAATGTGG + Intronic
941733030 2:168940068-168940090 GACACAATAATATTGAAATTAGG + Intronic
941801860 2:169668624-169668646 GACACAACAATATTGAAATCAGG - Intronic
941884917 2:170517948-170517970 GAAACAACAATATTGAAAGAAGG - Intronic
942110296 2:172675195-172675217 GACAGAACAATATTGAAATTGGG + Intergenic
942177871 2:173352326-173352348 GATAGAACAATATTGAAATTAGG - Intergenic
942238127 2:173932495-173932517 GACACAACAATATTGAAACTAGG - Intronic
942507773 2:176661586-176661608 GATACAACAATATTCAAATTAGG + Intergenic
942534133 2:176945587-176945609 GACACAACAATATTGAAATTAGG + Intergenic
942539921 2:177005265-177005287 GACACAACAATATTGAAACTAGG + Intergenic
942614869 2:177781147-177781169 GACACATCAATATGGAAATTAGG - Intronic
942747796 2:179255146-179255168 GACACAATAATACTGAAATTAGG + Intronic
942833180 2:180261422-180261444 GATGCAACAACATTGAAATTAGG - Intergenic
942876866 2:180810958-180810980 GACACAGCAATATTGAAATTAGG + Intergenic
942999308 2:182304629-182304651 GACACAATATTATTGAAATTAGG - Intronic
943123425 2:183766648-183766670 GACACAACAATATAGAAATTAGG - Intergenic
943292838 2:186097065-186097087 GACACAACAATATTAAATTTAGG + Intergenic
943330900 2:186557962-186557984 GACACAACAATATTGAAATCAGG - Intergenic
943420819 2:187667069-187667091 GACACAACAATATTAAAATTAGG + Intergenic
943516061 2:188888504-188888526 GATACAGAAATATTGAAATTTGG - Intergenic
943531676 2:189089921-189089943 GACACAACAACATTAAAATTAGG + Intronic
943604865 2:189965117-189965139 GATGCAACAATATTGATATTAGG - Intronic
943616553 2:190099332-190099354 GATACAACAATATTGAAATTAGG - Intronic
943695093 2:190918812-190918834 GACACAACAATATTGAAAACAGG - Intronic
943940932 2:193995381-193995403 GACACAACAATATTGAAATCAGG + Intergenic
943952499 2:194148263-194148285 GACACAACAATATTAAAGTTAGG - Intergenic
944003601 2:194874347-194874369 GACACAAGAATATTGAAATTAGG + Intergenic
944100777 2:196023868-196023890 GACAGAACAGTATTGAAATTAGG - Intronic
944138202 2:196424300-196424322 GACACAACAATATTGAAATTAGG + Intronic
944449279 2:199824666-199824688 GACACAACAGTATTGAAATTAGG - Intronic
944529583 2:200654039-200654061 GACACAATGATATTGAAATTAGG + Intronic
944623138 2:201539735-201539757 GACACAACAATATTGAAATTAGG + Intronic
944745262 2:202649310-202649332 GAGGCAACAATAGTGAAGATAGG - Intronic
945017296 2:205532603-205532625 AATGAAACTATTTTGAAATTTGG + Intronic
945126194 2:206513084-206513106 AACACAACAATTTTGAAATTAGG + Intronic
945189332 2:207169920-207169942 GACACAACAATAATGAAATTAGG + Intergenic
945442818 2:209900550-209900572 GACACAGCAATATTGAAATTAGG + Intronic
945487231 2:210410992-210411014 GACACCACAATATTGAAATTAGG - Intergenic
945541716 2:211095936-211095958 GACACAACAATATTGAAATTAGG + Intergenic
945690918 2:213034501-213034523 AATGCAAAAATACTGAAATTAGG - Intronic
945702768 2:213191655-213191677 GATGCTACAATCTTGAAATGGGG + Intergenic
945830197 2:214775323-214775345 GACACAAGAATATTGAATTTAGG - Intronic
946086317 2:217176834-217176856 GACCCAGCAATATTGAAATTAGG - Intergenic
946575237 2:221068366-221068388 GAAACAACAATATTAAAATTAGG + Intergenic
946645448 2:221828556-221828578 GACACAACAATATTGAAGTTAGG - Intergenic
946853176 2:223927876-223927898 GACACAACAATATTGAAATTAGG - Intronic
946901255 2:224374056-224374078 GACACAACAATGTTGAAATTAGG + Intergenic
947035480 2:225849203-225849225 AACACAACAATATTGAAATTAGG - Intergenic
947234622 2:227927061-227927083 GATGCAACAATATTGAAATTAGG + Intergenic
947554003 2:231073052-231073074 GACACAACAATATTGAAATTAGG - Intronic
947555439 2:231088715-231088737 GACACAATAATATTGAAATTAGG + Intronic
947754170 2:232549901-232549923 GACACAACAATATTGAGATTAGG - Exonic
1169032822 20:2424861-2424883 TACACAATAATATTGAAATTAGG - Intronic
1169322225 20:4642629-4642651 GACACAACAATATTGAAATTAGG + Intergenic
1169535177 20:6531231-6531253 GGCACAACAATACTGAAATTAGG - Intergenic
1169696009 20:8387327-8387349 GACACAACAATATTGAAATTAGG - Intronic
1169836693 20:9888238-9888260 GACACAACAATATGGAAATTAGG - Intergenic
1170114543 20:12843054-12843076 CATGCAAAAATATTGAATGTTGG + Intergenic
1170174332 20:13451937-13451959 GACACAAAAATATTGAAATTAGG - Intronic
1170237787 20:14126911-14126933 GAAACAACAGTATTGAAATTAGG + Intronic
1170247057 20:14232984-14233006 GACACAACAAGATTGGAATTAGG - Intronic
1170252261 20:14297203-14297225 GACACAACAATATTAAAATTAGG + Intronic
1170280583 20:14642599-14642621 GACACAACAATATTGAAATTAGG - Intronic
1170397141 20:15938624-15938646 AACACAACAATATTGAAATTAGG + Intronic
1170502078 20:16984518-16984540 GACACTACAATATTGAAATTAGG + Intergenic
1170561706 20:17564029-17564051 AAAGCAACAGTATAGAAATTGGG + Intronic
1170642715 20:18169630-18169652 GAGACAACAATATTGGAATTAGG + Intronic
1170650444 20:18235166-18235188 GACACAACAATACTGAAATCAGG - Intergenic
1170682796 20:18541543-18541565 GATACAACAATATTGAAATGAGG - Intronic
1170718542 20:18854083-18854105 GATGTAACTATTTTGAAACTTGG - Intergenic
1171251331 20:23650976-23650998 GACACAACAATATTAAAATTGGG - Intergenic
1172049208 20:32103494-32103516 GATGCAATAATATAGAAAGGTGG - Intergenic
1172236339 20:33378225-33378247 GACACAACAATATTGAAATTGGG - Intronic
1173653523 20:44683043-44683065 GATGCAATAACATAGAAAGTTGG + Intergenic
1173766799 20:45618574-45618596 GACACAACAATATTGAAATTGGG - Intronic
1173768236 20:45633239-45633261 GACATAACAATATTAAAATTAGG + Intergenic
1174379522 20:50147661-50147683 GATGGAAAAATATTCAGATTTGG - Intronic
1174652565 20:52140184-52140206 GACCCAACAATGTTGAAATTAGG + Intronic
1174834421 20:53842793-53842815 GACACAACAATACTGAAATTAGG + Intergenic
1175088373 20:56480714-56480736 GACACAACAATATTGAAATTAGG - Intronic
1175250337 20:57605609-57605631 GACACAACAATATTGAAATTAGG + Intronic
1176689725 21:9890527-9890549 GACACAACAATAGTGAAATTAGG - Intergenic
1176951164 21:15047979-15048001 GACACAACAATATTGAAATTAGG - Intronic
1177044042 21:16147045-16147067 GACACAACAATATTGAAATTAGG + Intergenic
1177162499 21:17563367-17563389 GACACAATGATATTGAAATTAGG - Intronic
1177167616 21:17620284-17620306 GACACAACAACATTGAAATTAGG - Intergenic
1177298466 21:19208103-19208125 GACACAAAAATATTGAAATTAGG - Intergenic
1177323872 21:19557755-19557777 GAGGCAACAATCGTGATATTTGG + Intergenic
1177331486 21:19670049-19670071 GAAACAACAATATTAAAATAAGG - Intergenic
1177400907 21:20604512-20604534 GACAAAACAATATTGAAATTTGG + Intergenic
1177413740 21:20767876-20767898 CACACAACAATATTAAAATTGGG - Intergenic
1177432839 21:21013035-21013057 GACACAACAATATTGAAATTAGG + Intronic
1177461447 21:21416162-21416184 GACACAATAATATTAAAATTAGG - Intronic
1177540058 21:22480953-22480975 GACATAAAAATATTGAAATTAGG + Intergenic
1177807938 21:25893271-25893293 GAGACAACAATATTGAAAGTGGG + Intronic
1178070680 21:28962610-28962632 GACACAACAATGCTGAAATTGGG + Intronic
1178382045 21:32118600-32118622 CACACAAAAATATTGAAATTAGG - Intergenic
1178816263 21:35932640-35932662 GATGCAGCAGTATTGATATCTGG + Intronic
1178835789 21:36096440-36096462 AATACAACACTATTGAAAGTTGG + Intergenic
1179148712 21:38792462-38792484 GGCACAACAATATTGAAATTAGG - Intergenic
1179220408 21:39401981-39402003 GACACAAAAATGTTGAAATTAGG + Intronic
1179322388 21:40304687-40304709 GACATAACAATATTGAAATTAGG - Intronic
1179386984 21:40952838-40952860 GACACAACAATATTGAAATTAGG + Intergenic
1179772053 21:43628091-43628113 GACACAACAATACTGAAATTCGG + Intronic
1179965140 21:44799921-44799943 GACAAAACAACATTGAAATTAGG - Intronic
1180113289 21:45676676-45676698 GACACAACAATATTGAAATTGGG + Intronic
1180465806 22:15609041-15609063 TACACAACAATATTGAAATTAGG - Intergenic
1180792405 22:18582894-18582916 CATGCAAAAATATTGATATATGG + Intergenic
1180848857 22:19000727-19000749 GACATAACAATATTAAAATTAGG - Intergenic
1180887776 22:19259731-19259753 GACACAACAATATTGAAATTAGG + Intronic
1180900091 22:19364736-19364758 GACAAAACAATATTGAAATTAGG + Intronic
1180932573 22:19603180-19603202 GACACAACAATATTGAAATTAGG - Intergenic
1181229332 22:21412424-21412446 CATGCAAAAATATTGATATATGG - Intergenic
1181249318 22:21522439-21522461 CATGCAAAAATATTGATATATGG + Intergenic
1181664051 22:24378639-24378661 GATATAAAAATATTAAAATTAGG - Intronic
1181930625 22:26398276-26398298 GACACAACAATATTGAAGTTAGG - Intergenic
1182514328 22:30844930-30844952 GACACAACATTATTGAAATTAGG - Intronic
1182605212 22:31497559-31497581 GAGGCAACAATATTGAAATTAGG + Intronic
1183008431 22:34924200-34924222 GACATAACAATATTGAAATTAGG - Intergenic
1183533293 22:38376482-38376504 GACACAACAATATTGAAAGTAGG - Intronic
1183612543 22:38919978-38920000 GATGTAACAATATTGAATTTAGG - Intergenic
1183681490 22:39332981-39333003 GATACAACAGTACTGAAATTAGG - Intergenic
1184082991 22:42238656-42238678 GACACAACAGTATTGAAGTTAGG - Intronic
1184831203 22:46989505-46989527 GACACAACAAGATTGATATTAGG - Intronic
1185084340 22:48730832-48730854 GAATCAACAATATTGAAATTAGG + Intronic
1185096943 22:48814043-48814065 GACGCAACAGCATTGAAATTAGG + Intronic
949270197 3:2207216-2207238 GACACAATAATATTGAAATTAGG + Intronic
949306591 3:2648646-2648668 GAAACAACAATATTGAAATTAGG + Intronic
949354504 3:3164137-3164159 GACACAACAATATTGAAACTAGG + Intronic
949411854 3:3774214-3774236 AATACAACAATATTGAAATTAGG + Intronic
949438355 3:4053153-4053175 GACACAACAATATTGAAATTAGG - Intronic
949623225 3:5839456-5839478 GAGACAACAATATTGAAAGGAGG - Intergenic
949626427 3:5871859-5871881 GGCACAACAATATTGAAATAAGG + Intergenic
949984648 3:9530988-9531010 GACACAACAGTTTTGAAATTAGG - Intronic
950315000 3:11994233-11994255 GACACAGCAATATTGAAATTAGG - Intergenic
950817883 3:15726131-15726153 GACACAACAGTATTAAAATTAGG + Intronic
951007105 3:17630608-17630630 GATATGACAATACTGAAATTAGG + Intronic
951089103 3:18551628-18551650 GCTTCAAGAATATTGAGATTGGG + Intergenic
951096790 3:18641685-18641707 GACACAACAATATTGAAATTAGG - Intergenic
951176333 3:19605167-19605189 GACATAACAATATTGAAAGTAGG - Intergenic
951422193 3:22499930-22499952 GACACAACAAGATTGAAATTAGG + Intergenic
951506983 3:23458201-23458223 GACGCAACAATACTGAAATTAGG - Intronic
951530066 3:23690569-23690591 GATACAACAATATAAAAATTAGG - Intergenic
951667114 3:25139150-25139172 GACACAACAATACTGAAATTAGG + Intergenic
951862398 3:27267720-27267742 GACACAATAATATTGAAATTAGG + Intronic
952003662 3:28815764-28815786 GACACAACAATATTGAAATTTGG - Intergenic
952084205 3:29797978-29798000 GATACAACAATATTGAAATTAGG - Intronic
952201180 3:31129537-31129559 GACACAAAAATACTGAAATTAGG - Intergenic
952262796 3:31756687-31756709 GATGAAACAATATTGGCTTTGGG + Intronic
952365489 3:32671258-32671280 GACACAGCAATATTGAAATTAGG - Intergenic
952515640 3:34102305-34102327 GATGCAACAATACTGAAATTAGG - Intergenic
952706033 3:36379312-36379334 GATGCTGCCATCTTGAAATTCGG - Intergenic
952774858 3:37035451-37035473 GACGCAATAATATGGAAACTAGG + Intronic
953148312 3:40300249-40300271 AATGTAACAATATTGAGAGTTGG - Intergenic
953486851 3:43307738-43307760 GATACAACAATATTGAAATTAGG + Intronic
953978025 3:47397014-47397036 GACACAATAATATTGAAATTAGG - Intronic
954944607 3:54409437-54409459 GACACAAGAATATTGAAATTAGG + Intronic
955211166 3:56942545-56942567 GACACACTAATATTGAAATTAGG + Intronic
955354446 3:58219032-58219054 AACATAACAATATTGAAATTAGG + Intergenic
955382275 3:58449135-58449157 GACACAACAATATTGAAATCAGG - Intergenic
955416603 3:58697830-58697852 GACACAACAATATTGACATGAGG - Intergenic
955426580 3:58797051-58797073 GGCACAGCAATATTGAAATTAGG + Intronic
955679570 3:61486480-61486502 GACACAACAATATTGAAGTTAGG - Intergenic
955773854 3:62413277-62413299 GATGCAAAAACATTGAAAGTAGG + Intronic
955831004 3:63004066-63004088 GACACAACAATATTGAAATTAGG - Intergenic
955938318 3:64123855-64123877 GACCAAACAATATTGAAATTAGG + Intronic
956063540 3:65373229-65373251 GATAAAGCAGTATTGAAATTAGG - Intronic
956180533 3:66513988-66514010 GACACAACAATATTGCAATTAGG - Intergenic
956960627 3:74396110-74396132 GACATAACAGTATTGAAATTAGG + Intronic
957126306 3:76165747-76165769 GATACAACAATATTGAAATTAGG - Intronic
957233535 3:77553373-77553395 GACACAACAGTATTGGAATTAGG + Intronic
957499721 3:81038832-81038854 GACATAAGAATATTGAAATTAGG - Intergenic
957518653 3:81290055-81290077 AACACAACAATATTGAAATTAGG - Intergenic
957627048 3:82666658-82666680 GACACAACAATACAGAAATTAGG - Intergenic
957955740 3:87184868-87184890 GACACAACTGTATTGAAATTAGG - Intergenic
958661622 3:97076022-97076044 GACACAACACTATTGAAATTAGG + Intronic
958718291 3:97814054-97814076 GACACAACAATATTGAAATTAGG - Intergenic
958821842 3:98983862-98983884 GCTGCAGCATTATTGACATTTGG - Intergenic
959014326 3:101115594-101115616 GATGCAAAACTATTGAAATTAGG + Intergenic
959031225 3:101301018-101301040 GTTACAGCAATATTGAGATTAGG - Intronic
959109782 3:102108587-102108609 GATACAATAATATGGAAATTAGG - Intronic
959174732 3:102892706-102892728 CATGCAAAAAAAATGAAATTGGG + Intergenic
959177485 3:102933497-102933519 GACAGAGCAATATTGAAATTAGG + Intergenic
959281099 3:104341828-104341850 GACACAACAATGTTAAAATTAGG - Intergenic
959390335 3:105764582-105764604 GACACAACAACACTGAAATTAGG + Intronic
959546350 3:107601232-107601254 AACACAACAATATTGAAATTAGG + Intronic
959821199 3:110737419-110737441 AAGGCAACAATATTGAAATTTGG - Intergenic
959898518 3:111633154-111633176 GACAAAACAATATTGAAATTAGG - Intronic
959923903 3:111900445-111900467 TAAGACACAATATTGAAATTAGG - Intronic
960035658 3:113100456-113100478 GACACAATAATACTGAAATTAGG - Intergenic
960045004 3:113188219-113188241 GACACAACAATATTGAAATCGGG + Intergenic
960097976 3:113706525-113706547 AACACAGCAATATTGAAATTAGG - Intergenic
960108339 3:113821381-113821403 GATGCAAAAATGTTCAAAATGGG - Intergenic
960154607 3:114286145-114286167 GGCACAACAATATTGAGATTAGG - Intronic
960242253 3:115358850-115358872 GATTTAACAGTATTGAAATGAGG - Intergenic
960258856 3:115541993-115542015 GATACAATGATATTGAAATTAGG - Intergenic
960381442 3:116967695-116967717 GACACAGTAATATTGAAATTAGG - Intronic
960382719 3:116984285-116984307 GACACAACAGTATTGAAGTTAGG + Intronic
960457953 3:117896826-117896848 GACACAACAGTATTGAAACTAGG + Intergenic
960549332 3:118956509-118956531 GACAAAACAATATTGAAATTAGG - Intronic
960644072 3:119858833-119858855 GACACAACAATATTGAAATTAGG - Intronic
960648073 3:119912148-119912170 GAGACAACAATATTGAAATTAGG - Intronic
960657367 3:120020635-120020657 GACACAACGATATTGAAATTAGG + Intronic
960753261 3:120979961-120979983 GTTGCATCAATAATGAAATTAGG - Intronic
961092155 3:124122770-124122792 GACGCAATAATATTGAAATTAGG + Intronic
961396327 3:126594109-126594131 GACACAGCAATATTGAAATTAGG - Intronic
962033488 3:131626138-131626160 GATACAACAATATTGAAATTAGG + Intronic
962115944 3:132507782-132507804 GAGTCAACAATATTGGAATTAGG + Intronic
962544124 3:136414870-136414892 GACAAAACAATATTGAAATTAGG - Intronic
962663580 3:137630602-137630624 GACACAAAAACATTGAAATTAGG - Intergenic
962836842 3:139197057-139197079 GACCCTACAATATTGAAATTAGG - Intronic
962836844 3:139197089-139197111 AATACAACAATATTGAAATTAGG - Intronic
963183831 3:142390891-142390913 GACATAGCAATATTGAAATTAGG - Intronic
963195232 3:142520262-142520284 GACATAAGAATATTGAAATTAGG + Intronic
963243027 3:143029583-143029605 GACACAACACTATTGAAATTAGG + Intronic
963485880 3:145933973-145933995 GAAGCTAGAATTTTGAAATTAGG + Intergenic
963507386 3:146204076-146204098 GACACAATAATATTGAAATTAGG - Intronic
963510718 3:146244707-146244729 GACAAAACAATATTGAAATTAGG + Intronic
963746730 3:149131630-149131652 GACACAACAATATTGAAATCAGG + Intronic
963773244 3:149411124-149411146 GACACAAGAATATTGAAATTGGG - Intergenic
964061543 3:152530443-152530465 GACACAACAATATTGTAATTAGG - Intergenic
964146622 3:153471810-153471832 GACACAATAATTTTGAAATTAGG - Intergenic
964469136 3:157033145-157033167 GCAAAAACAATATTGAAATTAGG + Intronic
964596954 3:158443875-158443897 GACACAACAATACTGAAATAAGG - Intronic
964813584 3:160692590-160692612 GACACAAGAATATTGAAATTAGG + Intergenic
964823304 3:160797405-160797427 GACACAACAATATTGAAATTAGG + Intronic
965005401 3:163016336-163016358 GACACAACAATATTTAAATTAGG + Intergenic
965141508 3:164841887-164841909 GACACGACAATATTGAAATTAGG + Intergenic
965235660 3:166117973-166117995 GACACAACAATGTTAAAATTAGG + Intergenic
965255663 3:166406614-166406636 GACAGAACAATACTGAAATTAGG - Intergenic
965264535 3:166524084-166524106 GAGGCAACAAAATTCACATTAGG + Intergenic
965276365 3:166687908-166687930 GACACAATAATATTGAAATTAGG + Intergenic
965424514 3:168505253-168505275 GACCCAGCAATATTGAAATTGGG - Intergenic
965438688 3:168685765-168685787 AACACAACAATATTGAAATTAGG + Intergenic
965458960 3:168937564-168937586 GACACAAAAATATTAAAATTAGG - Intergenic
965868022 3:173229578-173229600 GATATAACAATATTGAAATTAGG - Intergenic
965885533 3:173441502-173441524 GACACAACAATACTGAAACTAGG - Intronic
966070322 3:175869509-175869531 GACACAACAATATTAAAATTAGG + Intergenic
966095973 3:176203490-176203512 GACACAACAATATTAAAATTAGG + Intergenic
966116300 3:176467353-176467375 GACACAACAATATTGAAATTAGG + Intergenic
966214317 3:177486369-177486391 GACACAAAAATATTGAAATTAGG - Intergenic
966223219 3:177570851-177570873 GATAAAACAAAATAGAAATTAGG + Intergenic
966291357 3:178362815-178362837 GATTCACCAAGATTGAAATGAGG + Intergenic
966368215 3:179214360-179214382 GACACAACAATATTGAAATTAGG - Intronic
966644715 3:182231629-182231651 GACACAACAATATTGAAATGAGG - Intergenic
966750863 3:183320940-183320962 GACAGAACAATATTGAAATTAGG - Intronic
966798330 3:183738185-183738207 AGAACAACAATATTGAAATTAGG + Intronic
967491858 3:190101180-190101202 GACACAACAACACTGAAATTAGG + Intronic
967603655 3:191418139-191418161 GATACAACAATATTGAAATGAGG + Intergenic
967639482 3:191844231-191844253 GACTAAACAATATTGAAGTTAGG - Intergenic
967802734 3:193681899-193681921 GACACAACAATATTGAAATTTGG + Intronic
968244526 3:197129740-197129762 GATACAACAATATTGATATTAGG - Intronic
969152744 4:5184253-5184275 GACACAACAATACTGAAATTAGG - Intronic
969167340 4:5328450-5328472 GGCATAACAATATTGAAATTAGG - Intronic
969280007 4:6163521-6163543 GACACAACAATGCTGAAATTAGG + Intronic
970332038 4:14996502-14996524 GACAAAACAATATTGAAATTAGG + Intergenic
970390400 4:15604283-15604305 GACACAACAATATTGAAATTAGG - Intergenic
970528790 4:16960758-16960780 GACACAACAATATTGAAATTAGG + Intergenic
970578805 4:17454231-17454253 GACACAACAATATTGAAATTAGG + Intergenic
970629782 4:17927625-17927647 GATGCAACAGTATTGAAGTTAGG - Intronic
970847368 4:20556618-20556640 GACCCAACAATACTGAAATTAGG + Intronic
970884619 4:20973738-20973760 AACACAACAATAATGAAATTAGG - Intronic
971441272 4:26689808-26689830 GACACAACAATATAGAAATTAGG + Intronic
971542974 4:27844906-27844928 AAGGCAAAAATAATGAAATTAGG + Intergenic
971631651 4:28999985-29000007 TAAGAAACAATATTGAAATATGG + Intergenic
971648591 4:29240624-29240646 TATGAAAGAATATTGAAATATGG - Intergenic
971670830 4:29554918-29554940 AATGAAACAATAATGCAATTTGG - Intergenic
971881299 4:32377298-32377320 GACATAACAATATTAAAATTAGG - Intergenic
971918255 4:32903755-32903777 GATGCAATAATAATGAAAAATGG + Intergenic
972099410 4:35394201-35394223 GACACAATAATATTGAAATTAGG + Intergenic
972178086 4:36432131-36432153 GACACAACAATATTAAAATTAGG - Intergenic
972383702 4:38543300-38543322 GACACAACAATATTGAAATTAGG - Intergenic
972560323 4:40221688-40221710 GACACAATGATATTGAAATTAGG + Intronic
972615412 4:40693504-40693526 GAAACAACAATACTGAAATAAGG - Intergenic
972837346 4:42889043-42889065 AACCCAACAATATTGAAATTAGG + Intergenic
972948038 4:44282443-44282465 GGTACAACAATACTGAAATTAGG + Intronic
972952356 4:44343253-44343275 GACACAACAATATTGTAATCAGG - Intronic
973165174 4:47068535-47068557 GACACAAAAATACTGAAATTAGG - Intronic
973233849 4:47874397-47874419 GAAACAACAGTATTGAAATTAGG - Intronic
973235280 4:47895962-47895984 GAGACAACAATATTGAAATTAGG - Intronic
973850019 4:54952438-54952460 TCTACAGCAATATTGAAATTAGG - Intergenic
973901207 4:55473944-55473966 CATACAACAATACTGAAATTAGG + Intronic
973986647 4:56361022-56361044 TAGGCCACAACATTGAAATTCGG - Intronic
974316240 4:60284832-60284854 GACACAACAATAATGAAATTTGG + Intergenic
974336911 4:60559798-60559820 GACATGACAATATTGAAATTAGG - Intergenic
974346520 4:60689372-60689394 GACTCAGCAATATTGACATTAGG + Intergenic
974448719 4:62021901-62021923 GACACAGCAATATTGAAATTAGG + Intronic
974560949 4:63517242-63517264 GACACAACAATACTGAAATTAGG + Intergenic
974564113 4:63561796-63561818 GGCACAACAATATTGAAATTAGG + Intergenic
974613336 4:64246058-64246080 GAGACAACAATATTTAAATTAGG - Intergenic
974667361 4:64981673-64981695 GACACAACAATATTGAAATTAGG + Intergenic
974791727 4:66699358-66699380 GACACAACCATATTGAAGTTAGG - Intergenic
974816941 4:67017213-67017235 GACACAACAATATTAAAATCAGG - Intergenic
975114294 4:70661916-70661938 GAGGCAATTTTATTGAAATTAGG - Intronic
975124903 4:70770920-70770942 GACACAACAATACTGAAATTAGG - Intronic
975323014 4:73029359-73029381 GACACAACAATATTGAAATTAGG + Intergenic
975407650 4:74009779-74009801 GATATAATAATATTGAAATTAGG + Intergenic
975409209 4:74029127-74029149 GACACAGCAATATTAAAATTGGG - Intergenic
975501447 4:75089938-75089960 GACATAACAATATTGAAATCAGG + Intergenic
975567913 4:75779240-75779262 GACATAACAATATTGAAATCAGG + Intronic
975686541 4:76921475-76921497 GATACAACAGTATTAAAATCAGG - Intergenic
975762040 4:77630180-77630202 GACAGAACAATATTGAAATTAGG - Intergenic
975830126 4:78360484-78360506 GGTGGAATAATATTGAAAATTGG + Intronic
975880089 4:78894886-78894908 GACACAACAATATTGAAATTAGG - Intronic
975900373 4:79144620-79144642 GACACAACATTATTTAAATTTGG - Intergenic
975940675 4:79641518-79641540 GACACAACAATATTGAATTTAGG + Intergenic
976058535 4:81098613-81098635 GACACAACAGTATTGAAATCAGG - Intronic
976255926 4:83100680-83100702 GACACAACAATACTGAAATTAGG + Intronic
976432960 4:84984704-84984726 TACACAACAATATTGAGATTAGG + Intergenic
977024669 4:91802164-91802186 GACACAACAATATTTAAATTAGG + Intergenic
977105939 4:92884622-92884644 GGCAAAACAATATTGAAATTAGG - Intronic
977134237 4:93282613-93282635 AATGCAACAATATTGAGAGGTGG - Intronic
977356045 4:95948195-95948217 AACACAACAATATTCAAATTAGG - Intergenic
977434973 4:96982854-96982876 GATGTAAAAATATTAAAATTAGG - Intergenic
977568067 4:98601907-98601929 GACACAACAATATTGAAATTAGG - Intronic
977688339 4:99874874-99874896 GACACAACAGTATTGAAATTAGG - Intergenic
977852857 4:101850947-101850969 GACAAAACACTATTGAAATTAGG + Intronic
977981253 4:103325191-103325213 GACACAACAATATTGAAATTAGG - Intergenic
978018708 4:103781913-103781935 GACACAGCAATGTTGAAATTAGG - Intergenic
978083063 4:104618182-104618204 GAAACAACAATATTGAAGTTAGG - Intergenic
978134414 4:105239914-105239936 AACACAACAATATTGAAATTAGG - Intronic
978763049 4:112375934-112375956 GACACAAAAATATTAAAATTAGG - Intronic
979190065 4:117845837-117845859 GACAAAACAATTTTGAAATTAGG + Intergenic
979198024 4:117942875-117942897 GACACAATAATATTGAAATTAGG + Intergenic
979349106 4:119625892-119625914 CATGAAACAATATTCCAATTTGG - Intronic
979448839 4:120844658-120844680 GACACAACAATACTGAAATGAGG + Intronic
979520859 4:121665172-121665194 GACAAAACAATATTGAAATTAGG - Intergenic
979619305 4:122780684-122780706 GACACAACAATATTGAAGTTAGG - Intergenic
979625985 4:122846065-122846087 GACACAACAATATTAAAGTTAGG - Intronic
979659069 4:123231784-123231806 GACACAATAATAATGAAATTAGG - Intronic
979667605 4:123329381-123329403 CATACAACAACATTGAAAGTAGG + Intergenic
979729442 4:124006353-124006375 GACACAACATTATTGAAATTAGG - Intergenic
979823248 4:125200588-125200610 GACACAACTATATTAAAATTAGG + Intergenic
979846235 4:125516172-125516194 GACACAACACTGTTGAAATTAGG - Intergenic
979895652 4:126153170-126153192 GACACAATAATATTGAGATTAGG + Intergenic
980187863 4:129484803-129484825 GACACAACAATATTGGAATTAGG - Intergenic
980433697 4:132740250-132740272 GGCACAACAATATTGAAGTTAGG + Intergenic
980594754 4:134939283-134939305 GACACAACAATATTGACACTAGG + Intergenic
980635683 4:135498897-135498919 GATACAACACTATTAAAATTAGG - Intergenic
980640705 4:135574699-135574721 AACACAACAATATTAAAATTAGG - Intergenic
980654939 4:135769498-135769520 GACACAGCAATACTGAAATTAGG - Intergenic
980707026 4:136511570-136511592 GATAAAACAATATTGAAATTTGG - Intergenic
980760005 4:137220395-137220417 GACACAACAATATTGAAATTGGG + Intergenic
980825797 4:138071025-138071047 GATTCAACAATACTGCTATTGGG + Intergenic
980858379 4:138468624-138468646 GACACAACAATATTGAAAATAGG + Intergenic
981119609 4:141034675-141034697 GACCCAAAAATATTAAAATTAGG - Intronic
981164176 4:141537460-141537482 GACATAACAATATTGAAATTAGG - Intergenic
981412442 4:144448894-144448916 GACACAACAACATTGAATTTAGG - Intergenic
981439345 4:144765415-144765437 GACACAATAATATTGAAATTAGG - Intergenic
981458911 4:144989543-144989565 GACCCAACAATATTGAAATTAGG + Intronic
981462106 4:145025444-145025466 GACACAACAATATTGAAATTAGG - Intronic
981464413 4:145051188-145051210 GACACAACAATATTGAAATTAGG - Intronic
981493023 4:145361231-145361253 CAATCAACAATAGTGAAATTGGG + Intergenic
981526562 4:145712164-145712186 GACACAACAATATTGAAATTAGG + Intronic
981564743 4:146087965-146087987 GACACAGAAATATTGAAATTAGG - Intergenic
981628681 4:146791558-146791580 GACACAACAATATTGAAAAAGGG + Intronic
981806641 4:148723702-148723724 GACACAAAAATATTGAAATAAGG - Intergenic
981924483 4:150123315-150123337 GTTACAACAATACTGAAACTAGG - Intronic
982085110 4:151827238-151827260 GACACAACAATGTTGAAATTAGG - Intergenic
982149411 4:152436055-152436077 GACAAAACAATATTAAAATTAGG + Intronic
982169963 4:152651927-152651949 TACAGAACAATATTGAAATTAGG - Intronic
982247839 4:153371961-153371983 GACAAAACAATATTGAAATTAGG - Intronic
982344632 4:154344000-154344022 GACACAGCAATGTTGAAATTTGG - Intronic
982575706 4:157107203-157107225 GATACAACAACATTGAAATTAGG + Intronic
982681703 4:158438811-158438833 GACACAACAATATTGAAATTGGG + Intronic
982905620 4:161066476-161066498 GAAGAAAAAATATTGATATTAGG - Intergenic
982975014 4:162045240-162045262 GATGCAATAATACTGAAATTAGG - Intronic
983086689 4:163453899-163453921 GACGCAAAAATATTGAAATTAGG - Intergenic
983290235 4:165793552-165793574 GACACAACAATATTAAAATTAGG - Intergenic
983300890 4:165924104-165924126 GACACAACAGTATTGAAATTAGG + Intronic
983333135 4:166357295-166357317 GACACGACAATATTAAAATTAGG - Intergenic
983407634 4:167350049-167350071 GTTGCAACAAAAATGAAAATTGG - Intergenic
983464728 4:168073237-168073259 GACACAACAATATTGGAATTAGG - Intergenic
983583951 4:169336477-169336499 AATGCAACAGTATTGAAATGAGG - Intergenic
983597210 4:169483132-169483154 GACAAAATAATATTGAAATTAGG - Intronic
983652876 4:170051118-170051140 GACGCAACAATATTGAAATTAGG - Intergenic
983658480 4:170107554-170107576 GATGCAACAATATTGAAATTGGG - Intergenic
983758199 4:171369022-171369044 GAGACAATAATATTAAAATTAGG + Intergenic
983987397 4:174076231-174076253 GACACAAAGATATTGAAATTAGG - Intergenic
984068098 4:175075081-175075103 GACACAACAATATCGAAATTAGG - Intergenic
984104695 4:175530785-175530807 GAAACAACAGTATTGATATTAGG - Intergenic
984246796 4:177284454-177284476 GAAAAAACAATATCGAAATTAGG + Intergenic
984258597 4:177416975-177416997 GACAAAACAATATTGAAATTAGG - Intergenic
984461092 4:180037732-180037754 AATACAACAATATTGAAATTAGG + Intergenic
984479130 4:180276425-180276447 GACACAACAATATTGAAATTAGG + Intergenic
984567096 4:181344092-181344114 GACCCAACAATATTGAAATTAGG + Intergenic
984685561 4:182664447-182664469 GACAAAACAGTATTGAAATTAGG + Intronic
984877348 4:184381065-184381087 GACTCAGCAATTTTGAAATTGGG - Intergenic
985075807 4:186213219-186213241 TATGCTACAGTATTGAAATGTGG + Intronic
985430252 4:189872283-189872305 GACTCAACAATATGAAAATTAGG + Intergenic
985481738 5:116155-116177 GACACAATAATATTGAAATTAGG - Intergenic
985529536 5:425750-425772 GATGCTAAAATATTGCAATAAGG + Intronic
986190594 5:5493302-5493324 GATGCAACAATGTTTCAATGAGG + Intergenic
986618057 5:9640155-9640177 CTTGCAACAATATTAAAATGAGG - Intronic
986682184 5:10244059-10244081 GACACAACAACATTGAAATTAGG - Intronic
986738652 5:10686251-10686273 GACATAGCAATATTGAAATTAGG + Intronic
986880561 5:12165250-12165272 GACACAAGAATATTGAAATTAGG + Intergenic
986941589 5:12957166-12957188 GACACAACAATATTAAAATCAGG + Intergenic
987058646 5:14220382-14220404 GACACAACGATATTGAAATTAGG + Intronic
987237950 5:15962130-15962152 TAAGACACAATATTGAAATTAGG + Intergenic
987279903 5:16402451-16402473 GACATGACAATATTGAAATTAGG - Intergenic
987328959 5:16838082-16838104 GACACAACAATATTGAAATTGGG + Intronic
987529384 5:19097670-19097692 GACACAAAAATATTGAAATCAGG + Intergenic
987668853 5:20982566-20982588 GATACAACAATAATAAAATTAGG - Intergenic
987715946 5:21571147-21571169 GACACAACAATATTGAAATGAGG + Intergenic
987982391 5:25103082-25103104 GACACAACAATATTAAAATTAGG - Intergenic
988278680 5:29115376-29115398 GACACAATAATATTGAAATTAGG - Intergenic
988655530 5:33207346-33207368 GACACCACAGTATTGAAATTAGG + Intergenic
988665381 5:33321578-33321600 GAAGAAAAAATATTAAAATTAGG + Intergenic
988669759 5:33368797-33368819 GAGACAGCAATGTTGAAATTAGG - Intergenic
989001079 5:36761471-36761493 GACACAACAATATTGAAATTAGG - Intergenic
989128587 5:38081045-38081067 GGCACAACAATATTGAAATTTGG + Intergenic
989287815 5:39722632-39722654 GATACAACAGTATTGAAATTAGG - Intergenic
989303477 5:39922995-39923017 GACACAACAATATAGAAGTTAGG - Intergenic
989303512 5:39923544-39923566 GACTCAACAATATTGAAATTAGG - Intergenic
989375058 5:40752511-40752533 GACACAGCAATATTGAAATTAGG - Intronic
989532389 5:42523658-42523680 AACACAACAATATTGAAATTAGG + Intronic
989634239 5:43517186-43517208 GACACAACAATATCAAAATTAGG + Intergenic
989654098 5:43725868-43725890 GACACAATAATATTAAAATTAGG - Intergenic
989667998 5:43879309-43879331 GATACAAAAATATTGAATTTAGG - Intergenic
989802279 5:45557879-45557901 GACACAACAATATTGAAATTAGG + Intronic
990222666 5:53610217-53610239 GAGACAACAATATTGAAATTAGG - Intronic
990481589 5:56216356-56216378 GACACAACAATATTGAAATTAGG + Intronic
990523167 5:56599479-56599501 GACTCAACAATATTGAGATTAGG - Intronic
990674087 5:58163637-58163659 GATGCAACAATAATTGTATTAGG + Intergenic
990697479 5:58436839-58436861 GACACAACAGTATTGAAATTAGG - Intergenic
990788775 5:59453282-59453304 GACACAGCAATATTGAGATTAGG + Intronic
990832662 5:59977025-59977047 CACACAATAATATTGAAATTAGG + Intronic
990835928 5:60020072-60020094 GACACAACAATATTAAAATTAGG - Intronic
990885941 5:60593528-60593550 GACACAACAATATTGAAGTCAGG + Intergenic
990887495 5:60611355-60611377 GACACAACAATATTGAAATTGGG + Intronic
990979401 5:61588247-61588269 GATACAACAATATGGAAATTAGG + Intergenic
991104224 5:62825807-62825829 GACACAATAATATTGACATTAGG + Intergenic
991143118 5:63269738-63269760 GACACAACAATATTGAAATTAGG - Intergenic
992216723 5:74532021-74532043 CACAGAACAATATTGAAATTAGG + Intergenic
992271283 5:75065836-75065858 GTTCCGACAATATTGAAGTTAGG + Intergenic
992426631 5:76664235-76664257 GACACAATGATATTGAAATTAGG - Intronic
992462787 5:76977669-76977691 GACACAAGAATATTAAAATTAGG + Intronic
992598329 5:78369011-78369033 GACATTACAATATTGAAATTAGG - Intronic
992730558 5:79663496-79663518 GATGCAACAATACTGAAATTAGG - Intronic
992820631 5:80492564-80492586 GACACAAAAATATTGAAATTAGG + Intronic
992835958 5:80641612-80641634 GACACAACAATATTGAAATGAGG + Intronic
992918336 5:81482980-81483002 GACACAACAGTATTGAAATTGGG - Intronic
992922239 5:81537834-81537856 GACACAACAATATTGAAATTAGG + Intronic
993349608 5:86832438-86832460 GACAAAACAATATTAAAATTAGG - Intergenic
993393613 5:87354584-87354606 GACACAACACTATTAAAATTGGG + Intronic
993400451 5:87443459-87443481 GACACACCAATATTGAAGTTAGG - Intergenic
993709392 5:91209214-91209236 GACACAATAATATTAAAATTAGG - Intergenic
994466978 5:100148689-100148711 GATGCAACAATATTGAAATTAGG - Intergenic
994517461 5:100788704-100788726 TCCACAACAATATTGAAATTAGG - Intergenic
994625945 5:102219206-102219228 GACACAACAATATTGAAAATAGG - Intergenic
994736772 5:103565567-103565589 GATACAGCAATATTGAAATTAGG + Intergenic
994760977 5:103853713-103853735 GATGCAAAAATATTGAAATTAGG - Intergenic
994851424 5:105058538-105058560 GAAACAACAATATTGAAATTAGG + Intergenic
994870282 5:105339370-105339392 GACACAGCAATATTGAAATTAGG - Intergenic
994900726 5:105765290-105765312 GACACAACAGTACTGAAATTAGG - Intergenic
994937179 5:106270008-106270030 GACACAACAATATTGAAATCAGG - Intergenic
995339569 5:111042699-111042721 GACACAACAATATTGGAATTAGG - Intergenic
995426172 5:112025917-112025939 GATACAACAGTATTCAAATTAGG + Intergenic
995505797 5:112859770-112859792 AACACAACAATGTTGAAATTAGG - Intronic
995560429 5:113375184-113375206 AATGGAACAATGTTGAAATAAGG - Intronic
995670078 5:114593303-114593325 GACATAACAATATTAAAATTAGG - Intergenic
995678498 5:114690718-114690740 GACAAAATAATATTGAAATTAGG - Intergenic
996045796 5:118872486-118872508 GATACAACAATTTTGAAATTAGG - Intronic
996072840 5:119154144-119154166 GACATAACAATATAGAAATTAGG + Intronic
996209843 5:120794645-120794667 GACACAAGAATATTGAAATTAGG + Intergenic
996351970 5:122553880-122553902 CATACAACAATATTGAAATTAGG + Intergenic
996380232 5:122855841-122855863 GGACAAACAATATTGAAATTAGG - Intronic
996517681 5:124391200-124391222 GACACAACAATATTAAAATTAGG - Intergenic
996522976 5:124448013-124448035 GATGCAACACTTTAGAAATAAGG + Intergenic
996660418 5:125996277-125996299 GATGCAACAATATTGAAATTAGG + Intergenic
996841958 5:127856696-127856718 GACACAAGAATACTGAAATTAGG - Intergenic
996847594 5:127917554-127917576 GACACAACAATATTAAAATTAGG - Intergenic
996848101 5:127923193-127923215 GATACACTATTATTGAAATTTGG + Intergenic
997074273 5:130653571-130653593 GATGCAAGAATCTTTTAATTTGG - Intergenic
997274288 5:132570973-132570995 GACACAATAATATGGAAATTAGG - Intronic
997566640 5:134892779-134892801 GACACAACAATATTGAAATTAGG - Intronic
997577232 5:134989958-134989980 GATGTAACAATATTGAAGTTAGG - Intronic
997740975 5:136253716-136253738 ATTTCAACAATATTGATATTAGG + Intronic
997835462 5:137188640-137188662 GATAAAACAATATTGAAATTCGG + Intronic
998719126 5:144923203-144923225 GACATGACAATATTGAAATTAGG + Intergenic
998733878 5:145112413-145112435 GATGTAACTATGTTGAAATGAGG - Intergenic
998863666 5:146472612-146472634 GACACAACAATATTGAAATTAGG + Intronic
999497296 5:152111937-152111959 GACACAACACTATTGAAATTAGG - Intergenic
999514923 5:152291457-152291479 GACACAACAATATTGAAATTAGG + Intergenic
999524643 5:152391343-152391365 GACAAAACAATATTAAAATTAGG - Intergenic
999575860 5:152975917-152975939 GTTACAACAATATTGAAGTTAGG + Intergenic
999835141 5:155362143-155362165 AATTTCACAATATTGAAATTAGG - Intergenic
999856893 5:155604968-155604990 AACCCAATAATATTGAAATTAGG - Intergenic
1000129279 5:158279783-158279805 GACACAACAATATTCAAATTAGG + Intergenic
1000312587 5:160059598-160059620 GCCACAACAATATTGAAATTAGG - Intronic
1000453811 5:161423667-161423689 GACACAACAATATTGAAATTAGG + Intronic
1000462629 5:161542012-161542034 GACACAACAATATGGAAATTGGG - Intronic
1000532311 5:162438419-162438441 GACACAACAATATTGAAAATAGG + Intergenic
1000661161 5:163940210-163940232 GACACATCAATATTGAAATTAGG + Intergenic
1000782631 5:165502153-165502175 GACACAAAAATATTGAAATTAGG - Intergenic
1000863395 5:166483973-166483995 GACATAATAATATTGAAATTAGG - Intergenic
1000886696 5:166755781-166755803 GACACAATAATATTGAAATAAGG + Intergenic
1001369782 5:171187104-171187126 GACACAACAATATTGATATTAGG - Intronic
1001373138 5:171227048-171227070 GACACAGCAATATTGAAATCAGG + Intronic
1001479762 5:172080291-172080313 GACACAACGATATTGATATTAGG + Intronic
1001655885 5:173349249-173349271 GATACAACAATATTGAAGTTAGG + Intergenic
1002813107 6:653161-653183 GATGCGACAATATTGAAAGTAGG + Intronic
1002881736 6:1258386-1258408 AACACAACAATTTTGAAATTAGG + Intergenic
1002964908 6:1954811-1954833 GACACAACAATATTGAAATTAGG - Intronic
1003008062 6:2399977-2399999 GATACAATAATATTGAAATTAGG + Intergenic
1003085655 6:3058878-3058900 AACACAACAATATTTAAATTAGG + Intergenic
1003187735 6:3847860-3847882 GACACAGCAATATTGAAATTAGG - Intergenic
1003275050 6:4643319-4643341 GATACAATGATGTTGAAATTAGG - Intergenic
1003598758 6:7499325-7499347 GACACAACAATATTGAAATTAGG - Intergenic
1003662759 6:8078264-8078286 GACACAAGAGTATTGAAATTAGG - Intronic
1003706093 6:8532058-8532080 GACACAATGATATTGAAATTAGG + Intergenic
1003779736 6:9411326-9411348 GATGCAACAATGTTGAAAGGTGG + Intergenic
1003996168 6:11541833-11541855 GATACAACAATATTGAAATCAGG - Intronic
1004152832 6:13136731-13136753 GACACAACAATATTGAAACTGGG - Intronic
1004437474 6:15610405-15610427 GACCCAATAATATTGAAATCAGG + Intronic
1004569305 6:16830078-16830100 GACACAACAATATTGAGATTAGG - Intergenic
1004857182 6:19763156-19763178 GACACAACAATATTAAAATTAGG + Intergenic
1004922808 6:20392834-20392856 GACACAAAAATATTGAAATTAGG - Intergenic
1004926682 6:20422659-20422681 GAAACAAGAATACTGAAATTAGG - Intronic
1004978590 6:20996476-20996498 GATACAACAATATTGAAATTAGG - Intronic
1005216105 6:23530359-23530381 GATACAACAATATTGAAACTCGG - Intergenic
1005365778 6:25075474-25075496 GATGTGACACTACTGAAATTAGG - Intergenic
1005371994 6:25143336-25143358 GATGCAAAAATATTAATATCAGG + Intergenic
1005402234 6:25446843-25446865 GACACAACAATATTGAAATTAGG - Intronic
1005663831 6:28028826-28028848 GACACAAAAATGTTGAAATTAGG + Intergenic
1006050620 6:31340741-31340763 GATGCAAAAATATTAACGTTAGG - Intronic
1006455602 6:34130126-34130148 GAAGCAAAAAGATTGAACTTTGG - Intronic
1006707664 6:36035446-36035468 GACACAATAATACTGAAATTAGG + Intronic
1006875677 6:37293577-37293599 GACACAACAATATTCAAATTAGG + Intronic
1007246126 6:40464345-40464367 AATGCAACAATGTTGAGAGTTGG + Intronic
1007495364 6:42256656-42256678 CATGAGACAATATTGAAACTTGG + Intronic
1007685276 6:43663539-43663561 GACACAACAATCATGAAATTAGG - Intronic
1007759311 6:44123707-44123729 GTTGCAAAAGTATTTAAATTAGG + Intronic
1007863829 6:44945269-44945291 GACACAACAATACTGAAATTAGG + Intronic
1007884244 6:45207858-45207880 GATGCAACAAAATTGGAATTTGG + Intronic
1008125792 6:47666793-47666815 GACACAACAATATTGAAATTAGG + Intronic
1008161146 6:48077716-48077738 GATACAACAATATTGAAATTAGG - Intergenic
1008197680 6:48544658-48544680 GACACATCAATATTGAAATTAGG - Intergenic
1008255037 6:49288000-49288022 GACACAACAATATTGAAATTAGG - Intergenic
1008268902 6:49466076-49466098 GACACAATGATATTGAAATTAGG - Intronic
1008271064 6:49490740-49490762 GACACAACGATATTGAAATTAGG - Intronic
1008299091 6:49812275-49812297 CACAGAACAATATTGAAATTAGG - Intergenic
1008390758 6:50948654-50948676 GACACAACAATATTGAAATTAGG + Intergenic
1008622514 6:53284999-53285021 GATACAACAATATTGAAATTGGG + Intronic
1008977108 6:57439792-57439814 GATGCATGAAAATTAAAATTTGG - Intronic
1009000772 6:57710913-57710935 GACACAACAATATTGAAATTAGG - Intergenic
1009040859 6:58175441-58175463 GACACAACAATATTAAAATTAGG - Intergenic
1009165245 6:60332739-60332761 GATGCATGAAAATTAAAATTTGG - Intergenic
1009216719 6:60929973-60929995 GACACAACAATATTAAAATTAGG - Intergenic
1009431199 6:63568344-63568366 GACACAGCAATACTGAAATTAGG - Intronic
1009461075 6:63914158-63914180 GACACAACAATATTGAAATTAGG + Intronic
1009558928 6:65213737-65213759 GACACAACAATAGTAAAATTAGG + Intronic
1009647355 6:66423840-66423862 GACATAACAATATTGATATTAGG + Intergenic
1009723252 6:67504171-67504193 GACACAACAATATTTAAATTAGG + Intergenic
1009870664 6:69449468-69449490 AATGCAAGATAATTGAAATTAGG + Intergenic
1009919899 6:70044579-70044601 GGAACAACAATATTGAAATTAGG - Intronic
1009960784 6:70517923-70517945 GAAACAGCAATATTTAAATTAGG + Intronic
1010067414 6:71700536-71700558 GACACAACAGTATGGAAATTAGG + Intergenic
1010241399 6:73619041-73619063 GACACAACAATATTGAAATTAGG - Intronic
1010608463 6:77921718-77921740 GACAAAACAATATTGAAATCAGG - Intronic
1010966666 6:82217466-82217488 GATGCAAGAATATATAAAATGGG - Intronic
1011019796 6:82799715-82799737 GACACAACAATATTGAAGTTAGG + Intergenic
1011060689 6:83263268-83263290 GACACAACACTATTGAAATTAGG + Intronic
1011115672 6:83888652-83888674 GACCCAACAATATTGAGATTAGG + Intronic
1011231986 6:85172332-85172354 AATGCAATAATATGGAAATTGGG + Intergenic
1011391742 6:86861442-86861464 AACACAACAATATTGAAATTAGG - Intergenic
1011587883 6:88946411-88946433 GACACAATAATATTGAAATTAGG + Intronic
1011644631 6:89446042-89446064 GACACAGCAATATTAAAATTAGG + Intronic
1011829120 6:91349227-91349249 GACACAACAATATAGAAATTAGG + Intergenic
1011908510 6:92404642-92404664 TATACCACAATATTTAAATTAGG - Intergenic
1011935599 6:92772750-92772772 GACACAAAAATATTGAAATTAGG - Intergenic
1012109054 6:95203217-95203239 GACACAACTATATTTAAATTGGG - Intergenic
1012284474 6:97372208-97372230 CATACAACAATATTGAAATTAGG + Intergenic
1012287671 6:97412783-97412805 GATACAACAATATTAAAATTGGG - Intergenic
1012340061 6:98109838-98109860 GACACAACAATATGGAAATGAGG - Intergenic
1012365852 6:98439145-98439167 GACACAACAATACGGAAATTAGG - Intergenic
1012392608 6:98760030-98760052 GACACAACAATATTGAAATTAGG + Intergenic
1012564898 6:100636468-100636490 GACACAACAATATTGAAATTAGG + Intronic
1012727472 6:102833357-102833379 GACACAAAAATATTGAAATCAGG + Intergenic
1012799981 6:103813765-103813787 GACACAACAATATTGAAATTAGG - Intergenic
1012918448 6:105196283-105196305 GATATAACAATATTGGAATTAGG + Intergenic
1013030872 6:106331401-106331423 GACACTACAATATTGAAATTAGG + Intergenic
1013266458 6:108504346-108504368 GATACAACAACATTAAAATTAGG - Intronic
1013414699 6:109914152-109914174 GACACAACAATATTAAAATTAGG + Intergenic
1013550856 6:111206455-111206477 GTTTCATAAATATTGAAATTTGG + Intronic
1013569202 6:111403671-111403693 GACACTACGATATTGAAATTAGG + Intronic
1013699015 6:112740223-112740245 CAAGACACAATATTGAAATTAGG - Intergenic
1013796117 6:113891002-113891024 GATGCAACACTGTTGAAAGTAGG + Intergenic
1013933111 6:115559241-115559263 GACACAACAACATTGAAATTGGG + Intergenic
1014034888 6:116755030-116755052 GATGCAACAATATTGAAATTAGG + Intronic
1014076420 6:117240568-117240590 GACAAAACAATATTGAAATTAGG + Intergenic
1014262448 6:119235126-119235148 GATACTACAATATTGGAATCAGG + Intronic
1014319613 6:119910582-119910604 AACACAACAATATTGAAATTGGG + Intergenic
1014354273 6:120385051-120385073 GATACAGCAATATTGAAATTAGG - Intergenic
1014378389 6:120706360-120706382 AAAACAACAACATTGAAATTAGG - Intergenic
1014521526 6:122449149-122449171 GACACAACCATATGGAAATTAGG + Intronic
1014618024 6:123628284-123628306 GACACAACAATATTGAGATTAGG - Intronic
1014683185 6:124459681-124459703 GATGAAGCAATATTAACATTAGG - Intronic
1014705048 6:124735878-124735900 TACACAACAATATTGAAATTAGG + Intronic
1014856129 6:126403196-126403218 GACATAACAATATTGAAATTAGG + Intergenic
1014975546 6:127877514-127877536 GACACAACAATATCGAAATTAGG - Intronic
1015049772 6:128826159-128826181 GATGGAACTTTATTCAAATTTGG + Intergenic
1015144851 6:129974063-129974085 GAGACAATAATATTGACATTAGG + Intergenic
1015225715 6:130854785-130854807 TATCCAACTATATTGACATTAGG - Intronic
1015304191 6:131688295-131688317 GGCATAACAATATTGAAATTAGG + Intronic
1015381734 6:132577752-132577774 TATGCAAAAAAATTGAAACTGGG + Intergenic
1015821799 6:137269165-137269187 GATACAATAATATTGAAATCAGG - Intergenic
1015900956 6:138066122-138066144 GACACAACAATATTGAAATGAGG + Intergenic
1015939736 6:138436069-138436091 GATACAACAATAATGAAATTAGG + Intronic
1016081610 6:139864046-139864068 GACACAACAATATTGAAATCAGG + Intergenic
1016148575 6:140706755-140706777 GACACAACGATATTGAAATTGGG - Intergenic
1016220353 6:141661667-141661689 GAAACAGCAGTATTGAAATTTGG - Intergenic
1016222819 6:141696409-141696431 GACATATCAATATTGAAATTAGG + Intergenic
1016257161 6:142121263-142121285 GACTGAACAATATTGAAATTAGG + Intergenic
1016344166 6:143093754-143093776 GATTAAATAATATTGAAATTGGG - Intronic
1016571969 6:145523677-145523699 AACACAATAATATTGAAATTAGG + Intronic
1016579056 6:145607622-145607644 GATGAAACAAAAATGAAATTTGG + Intronic
1016608914 6:145965692-145965714 GACACAACAATATTGAAATTAGG + Intergenic
1016794072 6:148099044-148099066 CACACAACAACATTGAAATTAGG + Intergenic
1016848013 6:148588084-148588106 GATACAATAATATTGAAATTAGG + Intergenic
1016867400 6:148781011-148781033 GACACAACAATATTGAAATTAGG + Intronic
1016931564 6:149415774-149415796 GACACAACAATATTGAAATTAGG + Intergenic
1017068839 6:150554161-150554183 GACATAACACTATTGAAATTAGG + Intergenic
1017104157 6:150872420-150872442 GAAACAACAATATTGAAATTAGG - Intronic
1017243721 6:152198647-152198669 GACACAACAATATTGAAATTAGG - Intronic
1017298270 6:152825534-152825556 GACACAACAGTATTGAATTTAGG - Intergenic
1017314376 6:153013424-153013446 GAGAAAACAATATTGAAATTAGG + Intronic
1018076584 6:160221658-160221680 GACACAACCATATTGAAATTAGG - Intronic
1018249176 6:161851084-161851106 GATGCAACAATGTTGAGAGATGG + Intronic
1018404918 6:163469870-163469892 GGTGTAACAATGTTGAAATGAGG - Intronic
1018691724 6:166350843-166350865 TAAATAACAATATTGAAATTAGG - Intergenic
1018888137 6:167958823-167958845 GAAGAAACAATTCTGAAATTAGG - Intronic
1019230683 6:170559163-170559185 GACACAACAATATGGAAATTAGG + Intronic
1019263541 7:97565-97587 GACACAATAATATTGAAATTAGG - Intergenic
1019821976 7:3250909-3250931 GAAACAACAATGTTGAAATTAGG + Intergenic
1020596863 7:10217614-10217636 GGCACAGCAATATTGAAATTAGG - Intergenic
1020626192 7:10582472-10582494 GGCACAAGAATATTGAAATTAGG + Intergenic
1020765049 7:12308922-12308944 GACACAGTAATATTGAAATTAGG - Intergenic
1020802030 7:12743706-12743728 GATACAACAATATTGAAATTAGG + Intergenic
1020833343 7:13118487-13118509 GATACAACAATATTAAAATTAGG + Intergenic
1020859784 7:13477179-13477201 GACACAACAATATTGAAATTAGG - Intergenic
1020944555 7:14585984-14586006 GACACAACAGTATTGAAATTAGG + Intronic
1021267967 7:18548109-18548131 GACACAAGAATATTGAAATTAGG - Intronic
1021376562 7:19915103-19915125 GACACAAGAATATTGAAATTAGG - Intergenic
1021392020 7:20104365-20104387 AATGCAACAGTGTTGAAAGTGGG + Intergenic
1021483482 7:21143865-21143887 GAGGTAACAAGCTTGAAATTTGG - Intergenic
1021733042 7:23615682-23615704 GACATAACAATATTGAAATTAGG - Intronic
1021934100 7:25613287-25613309 GACACAAAAATATTGAAATTAGG - Intergenic
1021974778 7:26001089-26001111 GAAACAACAATATTGAAATTAGG - Intergenic
1022061972 7:26806180-26806202 GACATAACAATATTGAAATTAGG + Intronic
1022279910 7:28897324-28897346 GATATAACAATATTAAAATTAGG - Intergenic
1022424713 7:30257376-30257398 GACCCAACAATATTGAAATTAGG + Intergenic
1022682403 7:32561878-32561900 GATGCAGCAATATTTAAATTAGG - Intronic
1022690101 7:32641193-32641215 GACACAACAATATTAAAATTAGG + Intergenic
1022958858 7:35405957-35405979 GACACAACAATATTGAAATTAGG + Intergenic
1023026087 7:36051000-36051022 GACACAACAATATTGAAATTAGG + Intergenic
1023514788 7:40991188-40991210 GACACCACAATACTGAAATTAGG - Intergenic
1023667322 7:42537298-42537320 GACACACCAATATTGAAATAGGG + Intergenic
1023724373 7:43126970-43126992 GACACAACAATATGGAAATTAGG + Intronic
1023778449 7:43633369-43633391 GACACAACAGTATTGAAATTGGG - Intronic
1024336693 7:48215227-48215249 GACACAATGATATTGAAATTAGG - Intronic
1024549321 7:50548190-50548212 GATGTGACAAAATTGAAATTAGG + Intronic
1024786139 7:52910506-52910528 GACACAACAATATTGAAAATAGG - Intergenic
1024837900 7:53545430-53545452 GACACAATAATATTGCAATTAGG + Intergenic
1024852609 7:53738397-53738419 GACACAATAATATTGAAATCAGG + Intergenic
1024877278 7:54040187-54040209 GCTACAACATTATTAAAATTAGG - Intergenic
1024932525 7:54678851-54678873 GACACAACAATATGGAAATTAGG - Intergenic
1025073276 7:55920058-55920080 GACACAGCAATATTGAAATTAGG + Intronic
1025195922 7:56933287-56933309 GACACAGCAATACTGAAATTAGG + Intergenic
1025676026 7:63643649-63643671 GACACAGCAATACTGAAATTAGG - Intergenic
1025938404 7:66055696-66055718 GACAGAACAATATTGAAATTAGG + Intergenic
1025946057 7:66105560-66105582 GACAGAACAATATTGAAATTAGG - Intronic
1026108966 7:67443580-67443602 TATGCAAAAGAATTGAAATTAGG - Intergenic
1026256108 7:68713323-68713345 GACAAAACAGTATTGAAATTAGG - Intergenic
1026330551 7:69348490-69348512 GACACAGCAATATTGAAATTAGG - Intergenic
1026415346 7:70173909-70173931 GACACAACAATATTGAAATTAGG + Intronic
1026489995 7:70854993-70855015 GACACAGCAATATTGAAATTAGG - Intergenic
1026507734 7:71000099-71000121 GACACAACAATATTTAAATCAGG + Intergenic
1026642144 7:72136764-72136786 GATACAATAACACTGAAATTAGG - Intronic
1027275979 7:76556447-76556469 GACACAACAATATGGAAACTAGG + Intergenic
1027296227 7:76774400-76774422 GGTGCAACAATATTGAAATTAGG - Intergenic
1027512072 7:79095573-79095595 GACACAATAATATTGAAACTAGG - Intronic
1027573453 7:79901662-79901684 GATACAAAAATATTGAAATTGGG + Intergenic
1027596057 7:80175861-80175883 GACACAGGAATATTGAAATTAGG + Intronic
1027723548 7:81773636-81773658 AACACAACATTATTGAAATTAGG + Intergenic
1027917640 7:84346527-84346549 GACACAACAGTATTGATATTAGG - Intronic
1027944996 7:84733300-84733322 GAAACAACAATATTGAAATTAGG - Intergenic
1028064948 7:86372123-86372145 GATGTGATAATATTAAAATTAGG + Intergenic
1028101777 7:86829566-86829588 GACACAACAATATTTACATTAGG - Intronic
1028178301 7:87683500-87683522 GACACAACAATACTGAAATTAGG - Intronic
1028210066 7:88062809-88062831 GACAAAACAATATGGAAATTAGG - Intronic
1028296649 7:89141020-89141042 GATATAACAATATTGAAATTAGG - Intronic
1028366986 7:90043720-90043742 GACACAACAATATTGAAATTAGG + Intergenic
1028408611 7:90503589-90503611 GACACAGCAATATTGAAATGAGG - Intronic
1028829865 7:95315390-95315412 GATCCAACAGTGTTGGAATTGGG - Exonic
1028870535 7:95766733-95766755 GATACAACAATATTGAAATTAGG + Intergenic
1029022080 7:97375354-97375376 GAGACAACAATATTGAAATTAGG + Intergenic
1029049890 7:97674727-97674749 GACACAACAATATTGAAATTAGG + Intergenic
1029378112 7:100194334-100194356 GACACAAAAATATTGTAATTAGG - Intronic
1029674176 7:102055658-102055680 GACACAACAATATTGAAATTAGG + Intronic
1029890374 7:103922965-103922987 ATTGCAAAAAAATTGAAATTAGG + Intronic
1030038298 7:105427022-105427044 GACACAAAGATATTGAAATTAGG - Intergenic
1030098726 7:105925376-105925398 GACACAAAAATATTGAAATTAGG - Intronic
1030136870 7:106260736-106260758 GACACAACAGTATTTAAATTAGG - Intronic
1030242604 7:107345069-107345091 GACACAACAATATTGAAGTTAGG - Intronic
1030491296 7:110238299-110238321 TACACAACAATATTGAGATTAGG + Intergenic
1030499791 7:110345135-110345157 GAAACAACATTATTGAAATTAGG - Intergenic
1030567698 7:111180327-111180349 GACACAACAATATTGAAATTAGG - Intronic
1030587696 7:111441376-111441398 GACACAACAATATTGAAATTCGG - Intronic
1030698322 7:112610699-112610721 GTTACAACAATATTGAAATTAGG + Intergenic
1030992978 7:116323584-116323606 GACACAACACTATTGAAATTAGG + Intronic
1031331126 7:120465992-120466014 GTGGCAACACTATTGACATTTGG + Intronic
1031434743 7:121719089-121719111 GATATAACAATATTGAAATTAGG - Intergenic
1031498744 7:122485133-122485155 CACACAACAATATTAAAATTAGG + Intronic
1031588644 7:123563343-123563365 GATACAACAATGTTGAAATTAGG - Intergenic
1031716109 7:125110512-125110534 GACACAACAATATTGAAATAAGG - Intergenic
1031827297 7:126581967-126581989 GAAACAGTAATATTGAAATTAGG + Intronic
1031860215 7:126970852-126970874 GACACAACAATATTGGAATTAGG - Intronic
1031921536 7:127605479-127605501 AAGACAACAATATTGAAATTAGG - Intergenic
1032235509 7:130118747-130118769 GACACAACAAGATTGAAATTAGG - Intronic
1032374897 7:131403657-131403679 GATGCAACAATACTGAAATTAGG - Intronic
1032558608 7:132864243-132864265 GACGCAACAATACTAAAATTAGG - Intronic
1032701611 7:134385220-134385242 GACACAACAATATTCAAATGAGG + Intergenic
1032730374 7:134636300-134636322 GACACAACAACATTGGAATTAGG - Intergenic
1032769034 7:135029847-135029869 GACATAACAATATTGAAATTAGG - Intronic
1032778908 7:135146140-135146162 GACACAATAATACTGAAATTAGG - Intronic
1032861768 7:135886494-135886516 GATACAACAATATTGAAACTAGG + Intergenic
1033139825 7:138816206-138816228 GACACAACAATATTGAAATTAGG + Intronic
1033140886 7:138825335-138825357 GACACAACAGTATTGAAATTAGG + Intronic
1033241604 7:139684285-139684307 GATACAATAATATGGAAATTAGG + Intronic
1033386501 7:140881766-140881788 GACACAACAATATTGAAGTTAGG - Intronic
1033795299 7:144838412-144838434 GACACGACAGTATTGAAATTAGG + Intergenic
1033845927 7:145432111-145432133 GATGCAACAATATTGAAATTAGG - Intergenic
1034611697 7:152376250-152376272 CACACAACCATATTGAAATTAGG + Intronic
1034727516 7:153351851-153351873 GACATAACAATATTAAAATTAGG + Intergenic
1034743304 7:153498263-153498285 GACACAATAATATTGAAATTAGG + Intergenic
1035036045 7:155894755-155894777 GATACAACAATATTGAAATTAGG + Intergenic
1035066946 7:156112827-156112849 GATGCAGCAAAATTTAAACTAGG - Intergenic
1035092379 7:156324682-156324704 GAGACAACAATATAGAAATTAGG - Intergenic
1035144412 7:156799597-156799619 GACACAACGATATTGAAAGTAGG + Intronic
1035387092 7:158480434-158480456 GACACAACAATATTGAAATTAGG + Intronic
1035480027 7:159174910-159174932 GACTCAAGAATATTTAAATTTGG - Intergenic
1035958751 8:4113179-4113201 GACACAACAATATTGAAATTCGG + Intronic
1036198010 8:6738290-6738312 GACACAACAATATTGAAATTAGG - Intronic
1036395261 8:8365218-8365240 GATGTAACATAATTTAAATTGGG - Intronic
1036478177 8:9113355-9113377 GACATAACAATATTGAAATTAGG - Intronic
1037019692 8:13954756-13954778 GACACAACAATATTGAAACAGGG - Intergenic
1037120456 8:15279600-15279622 GACACAACAATACTGAAATTAGG + Intergenic
1037303732 8:17482462-17482484 TATACAACAATACTGGAATTAGG + Intergenic
1037428670 8:18785792-18785814 GACACAACAGTATTGAAATTAGG - Intronic
1038094909 8:24297570-24297592 GCTGCAACATTGGTGAAATTTGG + Intronic
1038424611 8:27456545-27456567 GACACAACAATATTGAAATTAGG + Intronic
1038621794 8:29150856-29150878 GACACAACCATATTGAAATTAGG + Intronic
1038837540 8:31144283-31144305 GATACAACAAAATTGAAATTAGG + Intronic
1039076789 8:33697732-33697754 GACATAACAATATTAAAATTAGG - Intergenic
1039266756 8:35833097-35833119 AATACAACAATATTGAAATCAGG + Intergenic
1039337363 8:36606586-36606608 TACACAACAATGTTGAAATTAGG - Intergenic
1039410599 8:37352120-37352142 GATGCAACTACTTTGACATTCGG - Intergenic
1039556190 8:38476873-38476895 GATACCACAATATTGAAATTAGG + Intergenic
1039701771 8:39969488-39969510 GACATAATAATATTGAAATTAGG + Intronic
1040033767 8:42849228-42849250 GACACAACAACATTGAAATTAGG - Intergenic
1040068081 8:43164866-43164888 GATACAACAATATTGAAATTAGG - Intronic
1040068135 8:43165400-43165422 GATACAACAATATTGAAATTAGG + Intronic
1040441275 8:47445478-47445500 GACACAACAGTATTGAAATCTGG + Intronic
1040701690 8:50074443-50074465 GCCACAACAATATTGAAATTAGG - Intronic
1040732398 8:50464443-50464465 GACACAACATTATTGAAATTAGG - Intronic
1041055410 8:53980698-53980720 GACACAACAATATTGAAATCAGG + Intronic
1041100136 8:54388214-54388236 GACACAATGATATTGAAATTAGG - Intergenic
1041432311 8:57796431-57796453 GACACAACAATATTGACATTAGG + Intergenic
1041450848 8:58005185-58005207 GACACAACAATATTGACATGAGG - Intronic
1041622037 8:59982820-59982842 GGCACAACAATATTGAAATTAGG - Intergenic
1041818541 8:62002592-62002614 TTTGCCACAATATTAAAATTAGG - Intergenic
1041926249 8:63240062-63240084 GACACAACAGTATTGAAGTTAGG - Intergenic
1041950341 8:63494269-63494291 CATGTAACAAAATTGAAATATGG - Intergenic
1042045533 8:64647095-64647117 GACACAACAACATTGAAGTTAGG - Intronic
1042257336 8:66818402-66818424 GATGCAATAAAATTAAAATAAGG - Intronic
1042409825 8:68451533-68451555 AACACAACAATTTTGAAATTAGG - Intronic
1042419413 8:68567988-68568010 GACACAGCAATACTGAAATTAGG - Intronic
1042635711 8:70871681-70871703 GACACAACAGTATTGAAATTAGG + Intergenic
1042686737 8:71450360-71450382 GACACAACAATAGTCAAATTAGG - Intronic
1042785804 8:72545614-72545636 GACACAACAATATTGAAAATAGG + Intronic
1042795455 8:72657998-72658020 GACCCAGCAATATTGAAATTAGG + Intronic
1042829604 8:73012112-73012134 AACACAACAAGATTGAAATTAGG - Intronic
1042851774 8:73223987-73224009 GACACAGCAATATTGAAATTAGG - Intergenic
1042882403 8:73508319-73508341 GACACAACAATATTGAAATGAGG - Intronic
1043173136 8:76990587-76990609 GACACAACAATGTTGAAATTAGG - Intronic
1043275725 8:78389771-78389793 GACACAACAATATTGAAATTAGG + Intergenic
1043420824 8:80096817-80096839 GACACAACAATATGGAAATTAGG + Intronic
1043658643 8:82706166-82706188 TATGCCACACTATTGAAATGAGG + Intergenic
1043687914 8:83111383-83111405 GACAAAATAATATTGAAATTAGG - Intergenic
1043846168 8:85166434-85166456 TATGAGACAATATTGAAATGTGG - Intergenic
1043944757 8:86237484-86237506 GACACAACAATATTAAAATTAGG - Intronic
1044089781 8:87984946-87984968 GACACAACAATATTGAAATTAGG - Intergenic
1044114322 8:88315686-88315708 AACACAACAATATTGAAATTAGG + Intronic
1044121774 8:88406170-88406192 GAAATAAAAATATTGAAATTGGG + Intergenic
1044223151 8:89693162-89693184 AACACAACAATATCGAAATTAGG + Intergenic
1044414442 8:91920205-91920227 AACACAACAATATTGAAATTAGG + Intergenic
1044461207 8:92446476-92446498 GGCACAACAGTATTGAAATTAGG + Intergenic
1044560132 8:93604692-93604714 GATGCTACAATATTTATCTTGGG + Intergenic
1044889501 8:96818121-96818143 GATACAACACCATTGAAATTAGG - Intronic
1045073164 8:98532271-98532293 GACATCACAATATTGAAATTAGG - Intronic
1045129532 8:99133661-99133683 GACAGAACAATATTGAAATTAGG - Intronic
1045131337 8:99157590-99157612 GACACAACAATATTGAAGTTAGG + Intronic
1045301284 8:100912667-100912689 AATGGAAAAATATTGACATTTGG + Intergenic
1045355432 8:101384328-101384350 GACACAACAATATTGAAATTAGG - Intergenic
1045400386 8:101810573-101810595 GATGCTACTAAATGGAAATTTGG - Intronic
1045455757 8:102377329-102377351 GATTAAACAATAAGGAAATTGGG - Intronic
1045563529 8:103289936-103289958 GACACAACAATATTGAAATTAGG - Intergenic
1045670268 8:104543530-104543552 GACACAACAATATTGAAATTAGG + Intronic
1045889601 8:107139466-107139488 GACACAACAACATTGAAATTGGG - Intergenic
1045907814 8:107369669-107369691 GACACAAAAATATTGAAATTAGG - Intronic
1045915792 8:107468940-107468962 GAAGCAAGAATAGTGAAATTGGG + Intronic
1045948545 8:107825712-107825734 GATACAACAATATTAAAATTAGG - Intergenic
1046182427 8:110668996-110669018 GACATAACAATATTAAAATTAGG + Intergenic
1046424016 8:114022701-114022723 GAAACAACAGTATTGAAATTAGG - Intergenic
1046534107 8:115486367-115486389 GATATGACAATATTGAACTTAGG + Intronic
1046743760 8:117855583-117855605 GACACAAAAATATTGAAATTAGG + Intronic
1047009888 8:120660842-120660864 GACATAACAATCTTGAAATTAGG - Intronic
1047049462 8:121094469-121094491 GACATAGCAATATTGAAATTAGG - Intergenic
1047400655 8:124543799-124543821 GACGCAGCAACAGTGAAATTAGG + Intronic
1047560412 8:125981541-125981563 GAGACAGCAGTATTGAAATTAGG + Intergenic
1048077590 8:131089665-131089687 GAGACAACAATCTTGAAATTAGG + Intergenic
1048079447 8:131109572-131109594 GACACAACAATCTTGAAATTAGG - Intergenic
1048433395 8:134391516-134391538 GATACAACAATATTGAAATTGGG + Intergenic
1048542510 8:135355373-135355395 AATGCCACATTAGTGAAATTAGG - Intergenic
1048824327 8:138409204-138409226 GACACAACAATACTGAAAATCGG - Intronic
1048902477 8:139051987-139052009 GACACAACGATATTAAAATTAGG + Intergenic
1049136643 8:140907889-140907911 GACACAATAATACTGAAATTAGG + Intronic
1049227452 8:141463200-141463222 GACACAACAACATTGAAATTAGG + Intergenic
1049629113 8:143642659-143642681 GATATAACAATATTGAGATTAGG - Intronic
1050349587 9:4727886-4727908 GACACAACAATATTGAAATTAGG - Intronic
1050380947 9:5029191-5029213 GACACAACAATATGGAAATTAGG - Intronic
1050383780 9:5061917-5061939 GACACAACAATAATGAAATTAGG - Intronic
1050384622 9:5074654-5074676 GAGACAACAATATTAAAATTAGG + Intronic
1050437305 9:5624738-5624760 GATGCAACAATATTGAAATTAGG - Intergenic
1050647640 9:7738682-7738704 GACACAATAATATTAAAATTAGG - Intergenic
1050653850 9:7802411-7802433 GATGCAAAAATATTGAAATTAGG - Intronic
1050699470 9:8322184-8322206 GACACAACAATATCGAAATTAGG + Intronic
1050792594 9:9493050-9493072 AATAAAACAATATTGAAATTAGG + Intronic
1051064390 9:13084870-13084892 GAGACAACACTATTGAAATTAGG + Intergenic
1051085016 9:13338391-13338413 GACATAACAATATTGAAATTAGG - Intergenic
1051088309 9:13377717-13377739 GAATGAACAATATTTAAATTTGG - Intergenic
1051201526 9:14631711-14631733 GATACAATAATGTTGAAATGAGG - Intronic
1051254141 9:15194904-15194926 GACAAAACAAAATTGAAATTAGG + Intronic
1051298251 9:15619140-15619162 GACACAACAATGTTGAAATGAGG + Intronic
1051473497 9:17476310-17476332 GACTCAACAATATTGCAGTTAGG + Intronic
1051601684 9:18881397-18881419 GATGCAGCAATATTAAAATTAGG - Intronic
1051753585 9:20370435-20370457 GATACAACAATACTGAAATTAGG + Intronic
1051797609 9:20891243-20891265 GACACAACAATATTGAAATTAGG + Intronic
1051945056 9:22558423-22558445 GACACAATAATATTAAAATTAGG - Intergenic
1051967931 9:22851757-22851779 GATACAGCAATATTGAAATTAGG - Intergenic
1052371347 9:27668522-27668544 GAAACAACAATGTTGAAACTAGG - Intergenic
1052423792 9:28277412-28277434 GACACAATCATATTGAAATTAGG + Intronic
1052442396 9:28514216-28514238 GACGCAACAACATTGAAATTAGG + Intronic
1052758727 9:32567835-32567857 GACACAACAATACTGAAATTAGG + Exonic
1053113754 9:35484310-35484332 GACACAACAATATTGAAATCAGG - Intergenic
1053132536 9:35624996-35625018 GACACAACAATCTTAAAATTAGG + Intronic
1053296486 9:36918073-36918095 GAGACATCAATACTGAAATTAGG + Intronic
1053465621 9:38306033-38306055 GACACAACCATATTGAAGTTAGG - Intergenic
1053575088 9:39351433-39351455 GACACAGGAATATTGAAATTAGG + Intergenic
1053620642 9:39810744-39810766 GACACAGCAATATTGAAATTAGG - Intergenic
1053626067 9:39873191-39873213 GACACAGCAATATTGAAATTAGG + Intergenic
1053779533 9:41590949-41590971 GACACAACAATAGTGAAATTAGG + Intergenic
1053839594 9:42179368-42179390 GACACAGGAATATTGAAATTAGG + Intergenic
1053878808 9:42570028-42570050 GACACAGCAATATTGAAATTAGG - Intergenic
1054096653 9:60910116-60910138 GACACAGGAATATTGAAATTAGG + Intergenic
1054118056 9:61185742-61185764 GACACAGGAATATTGAAATTAGG + Intergenic
1054167489 9:61801190-61801212 GACACAACAATAGTGAAATTAGG + Intergenic
1054217821 9:62377510-62377532 GACACAGCAATATTGAAATTAGG - Intergenic
1054232881 9:62531667-62531689 GACACAGCAATATTGAAATTAGG + Intergenic
1054263521 9:62896700-62896722 GACACAGCAATATTGAAATTAGG + Intergenic
1054589699 9:66996822-66996844 GACACAGGAATATTGAAATTAGG - Intergenic
1054670053 9:67779710-67779732 GACACAACAATAGTGAAATTAGG - Intergenic
1054839424 9:69720009-69720031 GATACAACAATATTGAAATTAGG + Intronic
1054984688 9:71247817-71247839 GATCCAACAATCATGAAATAGGG + Intronic
1055039515 9:71854240-71854262 GACATAACAATATTGAAATTAGG - Intergenic
1055150685 9:72995300-72995322 GACACGACAATATTGAAATTAGG + Intronic
1055297101 9:74844930-74844952 GATGCCACAGTGTTGAAATTAGG - Intronic
1055402400 9:75938253-75938275 GATACAACTATATTGAAATTGGG - Intronic
1055542711 9:77329472-77329494 AACACAACAATACTGAAATTAGG - Intronic
1055547548 9:77395256-77395278 GAAACAACAATATTGAAATTAGG - Intronic
1055760469 9:79601717-79601739 GAGACAACAGTATTGAAATTAGG + Intronic
1055807388 9:80111834-80111856 GACACAACAGTATTGAAATTAGG - Intergenic
1055906529 9:81300904-81300926 GATACAACAATATTGAAATTAGG + Intergenic
1056013164 9:82353971-82353993 GATTCAACATTAGAGAAATTTGG + Intergenic
1056093781 9:83230706-83230728 GATACAGCAATATTGAAATTAGG - Intergenic
1056227214 9:84507453-84507475 GATACAATAATATTGAAATTAGG + Intergenic
1056288903 9:85120993-85121015 AATGCAACAGTATTGAGAGTGGG - Intergenic
1056695576 9:88847662-88847684 GACATGACAATATTGAAATTAGG - Intergenic
1056979258 9:91293160-91293182 GACAAAACAGTATTGAAATTAGG + Intronic
1057240270 9:93401599-93401621 GACACAACAATATTGATATTAGG + Intergenic
1057370830 9:94471553-94471575 GATACAACGATGTTGAAATTAGG + Intergenic
1057449746 9:95146776-95146798 CATGCAACAATTTTCAAAGTGGG + Intronic
1057543233 9:95995916-95995938 AATGCAACAGTATTGAAGTTAGG + Intronic
1058223629 9:102333448-102333470 GACACAAGAATATTGATATTAGG - Intergenic
1058628140 9:106957223-106957245 GCCACGACAATATTGAAATTAGG - Intronic
1058638794 9:107063179-107063201 GACACAACAATATTGAAATTAGG - Intergenic
1058641709 9:107093474-107093496 GAGACAACAATATTGAAATTAGG - Intergenic
1059092994 9:111381242-111381264 GACACAACAATATTGGAATTAGG - Intronic
1059196738 9:112377593-112377615 TATGCAACATTAATGTAATTTGG - Intergenic
1059558902 9:115311826-115311848 GATACAACAATAATGAAATTAGG + Intronic
1059590204 9:115650685-115650707 GACACACCAGTATTGAAATTAGG - Intergenic
1059603448 9:115807109-115807131 GGTGCAACAACATTAAAATTAGG - Intergenic
1059711854 9:116875007-116875029 GACACCACAATATTGAAATCAGG + Intronic
1059844289 9:118255306-118255328 GACACAAGAATATTGAAATTAGG + Intergenic
1059849035 9:118316142-118316164 AATTAAACAATTTTGAAATTAGG - Intergenic
1059917499 9:119119655-119119677 GACAAAACAATATTGAAATTAGG + Intergenic
1060066458 9:120505425-120505447 GATACAACAAAATTGAAATTAGG + Intronic
1060565208 9:124584741-124584763 AACCCAACAACATTGAAATTAGG + Intronic
1061494590 9:130964862-130964884 GATACAATAATATTGAAAGTAGG + Intergenic
1186256006 X:7720644-7720666 GACACAGCAATATTGAAATTAGG - Intergenic
1186535750 X:10346128-10346150 GACACAACAATATTGAAATCAGG + Intergenic
1186706771 X:12148039-12148061 GACATAACAATATTGAAATCAGG + Intronic
1186942332 X:14523645-14523667 GACACAACAATATTGAAATGAGG - Intergenic
1186953338 X:14652767-14652789 GACACAGCAATATTGAAATTAGG + Intronic
1186994795 X:15108525-15108547 GACACAACAATATTGAAATTTGG + Intergenic
1187311032 X:18142918-18142940 GACAAAACAATATTGAAATTAGG + Intergenic
1187452275 X:19409127-19409149 GAAACATCAGTATTGAAATTAGG - Intronic
1187474454 X:19598646-19598668 TATGTAACAATGTTGAAATGAGG - Intronic
1187516623 X:19977147-19977169 GACACAATAATATTGAAATGAGG + Intergenic
1187662920 X:21570707-21570729 GAAACAACAGTATTAAAATTAGG - Intronic
1187800414 X:23056079-23056101 GAAACAAAAATATTGAAATTAGG + Intergenic
1187814939 X:23221357-23221379 GAGACAACAATATTGAAATTGGG - Intergenic
1187890359 X:23928817-23928839 GACACAACAATATTGAAATTAGG + Intronic
1188221932 X:27551148-27551170 AGCACAACAATATTGAAATTAGG + Intergenic
1188231040 X:27663664-27663686 GACACAACAATGTTGAAATTAGG + Intronic
1188425157 X:30037705-30037727 CCTTAAACAATATTGAAATTAGG + Intergenic
1188432660 X:30122618-30122640 GACACAATAATATTAAAATTAGG + Intergenic
1188448225 X:30280017-30280039 CACACAACAATATTGAAATTGGG + Intergenic
1188461522 X:30432572-30432594 GGTGCTACTATATTGAAATTGGG - Intergenic
1188469150 X:30517719-30517741 GAGTCAACAATATTGAAATTAGG + Intergenic
1188540563 X:31245857-31245879 GACACAACAATATTAAAATCAGG + Intronic
1188822158 X:34788715-34788737 GACACAAAAATATTGAAATTAGG - Intergenic
1189072450 X:37878052-37878074 GACCCAACAATATTGAAATTAGG + Intronic
1189768493 X:44396625-44396647 GACACAACAATATTGAAATTAGG + Intergenic
1189788021 X:44577087-44577109 GACACAACAATATTGAAATTAGG + Intergenic
1189923095 X:45922751-45922773 GACACAACAATATTAAAATTAGG + Intergenic
1189942617 X:46141213-46141235 GATACAACAGTACTGAAATTAGG + Intergenic
1190141920 X:47854599-47854621 GACACAACAATATTGAAATTAGG - Intronic
1190171966 X:48118656-48118678 GACACAGCAATACTGAAATTAGG - Intergenic
1190189501 X:48265421-48265443 GATACAGCGATACTGAAATTAGG - Intronic
1190196678 X:48325714-48325736 GACACAGCAATACTGAAATTAGG - Intergenic
1190658262 X:52631922-52631944 GACACAGCAATACTGAAATTAGG - Intergenic
1190660178 X:52646727-52646749 GACACACCTATATTGAAATTAGG + Intronic
1190663406 X:52676085-52676107 GACACAGCAATACTGAAATTAGG - Intronic
1190676017 X:52782397-52782419 GACACAGCAATACTGAAATTAGG + Intronic
1191051737 X:56200429-56200451 CATGCAAAAAAAGTGAAATTGGG + Intergenic
1191171811 X:57455140-57455162 ACTGTAACAATATTGAAAATAGG - Intronic
1191728967 X:64313694-64313716 GACACAACAATATTGAAATTAGG - Intronic
1191773818 X:64790643-64790665 AACACAACAATATTGAAATTAGG + Intergenic
1192065593 X:67881363-67881385 TATGGAACAAAATTAAAATTTGG - Intergenic
1192084601 X:68083791-68083813 GACACAACAATATTGGAATTAGG - Intronic
1192301915 X:69913844-69913866 GACACAACAACATTGAAAATAGG - Intronic
1192328667 X:70155965-70155987 GACACAACAATATTGAAATTGGG - Intronic
1192720309 X:73689177-73689199 GACAAAATAATATTGAAATTAGG - Intergenic
1192980889 X:76340028-76340050 GACATAACAATATTAAAATTAGG + Intergenic
1193080119 X:77398402-77398424 GGTGCAACAAAATTGCAAATGGG + Intergenic
1193218094 X:78888308-78888330 GATGCAACAATACTGAAATTAGG + Intergenic
1193331585 X:80240633-80240655 GATGCAATAATATTGAAGTTAGG + Intergenic
1193396116 X:80985632-80985654 GACACAACAGTATTGAAATTAGG - Intergenic
1193971269 X:88056902-88056924 GACACAGCAATATTGAAATTAGG + Intergenic
1194062922 X:89226781-89226803 GAGACAAGAATATTAAAATTAGG - Intergenic
1194180878 X:90711206-90711228 GACACAACAATATTTAAATTAGG + Intergenic
1194276205 X:91885927-91885949 GATTTAACAGTATTTAAATTTGG + Intronic
1194326320 X:92522273-92522295 CACACAACAATATTGAAATCAGG - Intronic
1194580383 X:95664757-95664779 AACACAAGAATATTGAAATTGGG + Intergenic
1194591237 X:95802414-95802436 GACACACAAATATTGAAATTAGG + Intergenic
1194940222 X:100000214-100000236 GACACAATTATATTGAAATTGGG + Intergenic
1195150480 X:102063891-102063913 GATGCAAAAAAGTTGAACTTTGG - Intergenic
1195231168 X:102849801-102849823 GACACAACAATATTGAAATTAGG - Intergenic
1195338740 X:103883501-103883523 GACACAACAATATTGAAATTAGG + Intergenic
1195531999 X:105968217-105968239 AATGCAACAATATTAAGAGTTGG - Intergenic
1195593315 X:106657638-106657660 GACAAAATAATATTGAAATTAGG - Intronic
1195628375 X:107028355-107028377 GACACAACAATATTGAAATTAGG - Intergenic
1195690900 X:107624363-107624385 GGGACAACACTATTGAAATTAGG - Intergenic
1195792615 X:108605309-108605331 GACATAACAATATTGAAATTAGG - Intronic
1195800075 X:108698675-108698697 CATGCAACAATTTAAAAATTAGG - Intergenic
1195987914 X:110651313-110651335 GGCACAGCAATATTGAAATTAGG - Intergenic
1196029333 X:111078606-111078628 GACACAACAATATTGAAATTAGG + Intronic
1196067310 X:111478380-111478402 GAAACAGCAATACTGAAATTAGG - Intergenic
1196138189 X:112232457-112232479 GATGCAAAAATACAGAAAATGGG - Intergenic
1196260355 X:113572124-113572146 CTCACAACAATATTGAAATTAGG - Intergenic
1196333370 X:114498928-114498950 GACACAACAATATTGAAATTAGG - Intergenic
1196504779 X:116428508-116428530 AACACAACAGTATTGAAATTAGG + Intergenic
1196564060 X:117183842-117183864 GAGATAACTATATTGAAATTAGG + Intergenic
1196578025 X:117343850-117343872 GACACAACACTATTGAAATTAGG - Intergenic
1196619084 X:117801661-117801683 GACACAAGAATATTGAAATTAGG - Intergenic
1197114059 X:122811075-122811097 GACTGAACAAAATTGAAATTAGG + Intergenic
1197129342 X:122986719-122986741 GGCACAACAATATTGAAATTAGG - Intergenic
1197423273 X:126264602-126264624 GACACAACAATATTGAAATTAGG - Intergenic
1197444152 X:126528066-126528088 GAGGCAACAATATTGAAGTTAGG - Intergenic
1197456367 X:126680804-126680826 GACACAATACTATTGAAATTAGG - Intergenic
1197529220 X:127602073-127602095 GATACAAAAATATTAAAATTAGG + Intergenic
1197992106 X:132329410-132329432 AATGCAACAGTATTAAAATGTGG - Intergenic
1198034613 X:132788481-132788503 GACACAACAATACTGAAATTAGG + Intronic
1198137145 X:133764508-133764530 AATGTAACAATGTTAAAATTAGG + Intronic
1198281408 X:135146480-135146502 GGCGCAACAATATGGAAATTAGG - Intergenic
1198289551 X:135226036-135226058 GGCGCAACAATATGGAAATTAGG + Intergenic
1198323133 X:135539754-135539776 GACACAACAATATTGAAATCAGG - Intronic
1198607014 X:138351814-138351836 GGCACAAGAATATTGAAATTAGG + Intergenic
1198690357 X:139276726-139276748 GACACAGCAATATTGAATTTAGG - Intergenic
1198826593 X:140704886-140704908 GACAAAACAATAATGAAATTAGG - Intergenic
1198970678 X:142275597-142275619 GACAAAACAATATTGAATTTAGG - Intergenic
1199090643 X:143688030-143688052 GACATAACAATATTGAAATTAGG - Intergenic
1199103025 X:143828023-143828045 GACAAAACAATGTTGAAATTAGG + Intergenic
1199359256 X:146898461-146898483 GACACAACAATCTTAAAATTAGG + Intergenic
1199409329 X:147502299-147502321 GATTCAGCAACATTGTAATTAGG + Intergenic
1200371795 X:155734277-155734299 AATACAACAGTATGGAAATTAGG - Intergenic
1200514113 Y:4120546-4120568 TACACAAAAATATTGAAATTAGG - Intergenic
1200527538 Y:4293361-4293383 GACACAACAATATTTAAATTAGG + Intergenic
1200593455 Y:5107380-5107402 GATTTAACAGTATTTAAATTTGG + Intronic
1200716734 Y:6555449-6555471 GAGACAAGAATATTAAAATTAGG - Intergenic
1201143736 Y:11050031-11050053 AACACAATAATATTGAAATTAGG + Intergenic
1202594146 Y:26519546-26519568 GACACAACACTATTGAAAGTAGG + Intergenic