ID: 1033845932

View in Genome Browser
Species Human (GRCh38)
Location 7:145432151-145432173
Sequence CTGAGGAGAAGGAGAGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033845927_1033845932 17 Left 1033845927 7:145432111-145432133 CCTAATTTCAATATTGTTGCATC 0: 10
1: 55
2: 335
3: 638
4: 817
Right 1033845932 7:145432151-145432173 CTGAGGAGAAGGAGAGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033845932 Original CRISPR CTGAGGAGAAGGAGAGATGA GGG Intergenic
No off target data available for this crispr