ID: 1033850007

View in Genome Browser
Species Human (GRCh38)
Location 7:145483438-145483460
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033850003_1033850007 18 Left 1033850003 7:145483397-145483419 CCTCTTTTACTTTAAACCATGGA No data
Right 1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG No data
1033850005_1033850007 2 Left 1033850005 7:145483413-145483435 CCATGGAAAAAGGACCTAACAAA 0: 39
1: 40
2: 27
3: 29
4: 254
Right 1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033850007 Original CRISPR ATGCCCTTCTAGAAGAGTAA AGG Intergenic
No off target data available for this crispr