ID: 1033863357

View in Genome Browser
Species Human (GRCh38)
Location 7:145658543-145658565
Sequence TCCCTGACTAGTTATGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033863357_1033863360 -1 Left 1033863357 7:145658543-145658565 CCTACCTCATAACTAGTCAGGGA No data
Right 1033863360 7:145658565-145658587 AAGAATACAATGGAGAAAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033863357 Original CRISPR TCCCTGACTAGTTATGAGGT AGG (reversed) Intergenic
No off target data available for this crispr