ID: 1033864487

View in Genome Browser
Species Human (GRCh38)
Location 7:145672255-145672277
Sequence GACTGCTCAGGGGCCAGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033864481_1033864487 24 Left 1033864481 7:145672208-145672230 CCAGACTCTTAATTGTGGGTATT No data
Right 1033864487 7:145672255-145672277 GACTGCTCAGGGGCCAGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033864487 Original CRISPR GACTGCTCAGGGGCCAGAAT AGG Intergenic
No off target data available for this crispr