ID: 1033880104

View in Genome Browser
Species Human (GRCh38)
Location 7:145870733-145870755
Sequence AACATTTAGAAATATGTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033880103_1033880104 -7 Left 1033880103 7:145870717-145870739 CCTTGGAAAAGTTTTCAACATTT No data
Right 1033880104 7:145870733-145870755 AACATTTAGAAATATGTTCTTGG No data
1033880102_1033880104 -6 Left 1033880102 7:145870716-145870738 CCCTTGGAAAAGTTTTCAACATT No data
Right 1033880104 7:145870733-145870755 AACATTTAGAAATATGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033880104 Original CRISPR AACATTTAGAAATATGTTCT TGG Intergenic
No off target data available for this crispr