ID: 1033881513

View in Genome Browser
Species Human (GRCh38)
Location 7:145889606-145889628
Sequence CACATGGAAATGTCTCAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033881510_1033881513 0 Left 1033881510 7:145889583-145889605 CCATAACGTAAGGTTATCAGTGG No data
Right 1033881513 7:145889606-145889628 CACATGGAAATGTCTCAGATAGG No data
1033881507_1033881513 26 Left 1033881507 7:145889557-145889579 CCAAACCAGTTATTCTTTGAGTG No data
Right 1033881513 7:145889606-145889628 CACATGGAAATGTCTCAGATAGG No data
1033881508_1033881513 21 Left 1033881508 7:145889562-145889584 CCAGTTATTCTTTGAGTGTGTCC No data
Right 1033881513 7:145889606-145889628 CACATGGAAATGTCTCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033881513 Original CRISPR CACATGGAAATGTCTCAGAT AGG Intergenic
No off target data available for this crispr