ID: 1033897513

View in Genome Browser
Species Human (GRCh38)
Location 7:146092384-146092406
Sequence CACTGAATAAGGAGTTACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033897513_1033897518 15 Left 1033897513 7:146092384-146092406 CCTTTGTAACTCCTTATTCAGTG No data
Right 1033897518 7:146092422-146092444 GTTTAAATCAGCCTTGGTGAGGG No data
1033897513_1033897516 9 Left 1033897513 7:146092384-146092406 CCTTTGTAACTCCTTATTCAGTG No data
Right 1033897516 7:146092416-146092438 TAATACGTTTAAATCAGCCTTGG No data
1033897513_1033897517 14 Left 1033897513 7:146092384-146092406 CCTTTGTAACTCCTTATTCAGTG No data
Right 1033897517 7:146092421-146092443 CGTTTAAATCAGCCTTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033897513 Original CRISPR CACTGAATAAGGAGTTACAA AGG (reversed) Intergenic
No off target data available for this crispr