ID: 1033897580

View in Genome Browser
Species Human (GRCh38)
Location 7:146093716-146093738
Sequence GTGAAGAAACAAAGTGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033897575_1033897580 -8 Left 1033897575 7:146093701-146093723 CCCTCACAGTCCCAAGTGAAGAA No data
Right 1033897580 7:146093716-146093738 GTGAAGAAACAAAGTGAGAAGGG No data
1033897576_1033897580 -9 Left 1033897576 7:146093702-146093724 CCTCACAGTCCCAAGTGAAGAAA No data
Right 1033897580 7:146093716-146093738 GTGAAGAAACAAAGTGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033897580 Original CRISPR GTGAAGAAACAAAGTGAGAA GGG Intergenic
No off target data available for this crispr