ID: 1033898637

View in Genome Browser
Species Human (GRCh38)
Location 7:146107966-146107988
Sequence CTCAGTTTCAACTTGCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033898632_1033898637 29 Left 1033898632 7:146107914-146107936 CCTATTTGGTCTTTCAGGGGACT No data
Right 1033898637 7:146107966-146107988 CTCAGTTTCAACTTGCTGCATGG No data
1033898634_1033898637 -3 Left 1033898634 7:146107946-146107968 CCTTCCAAGTGGTAAGCAACCTC No data
Right 1033898637 7:146107966-146107988 CTCAGTTTCAACTTGCTGCATGG No data
1033898635_1033898637 -7 Left 1033898635 7:146107950-146107972 CCAAGTGGTAAGCAACCTCAGTT No data
Right 1033898637 7:146107966-146107988 CTCAGTTTCAACTTGCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033898637 Original CRISPR CTCAGTTTCAACTTGCTGCA TGG Intergenic
No off target data available for this crispr