ID: 1033907355

View in Genome Browser
Species Human (GRCh38)
Location 7:146221977-146221999
Sequence AAGTGTTTGTGAAAGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033907351_1033907355 17 Left 1033907351 7:146221937-146221959 CCTCAGTGCCTAGCATGGTAGCA 0: 2
1: 0
2: 3
3: 42
4: 374
Right 1033907355 7:146221977-146221999 AAGTGTTTGTGAAAGGAAGGAGG No data
1033907352_1033907355 9 Left 1033907352 7:146221945-146221967 CCTAGCATGGTAGCAGCACATCA 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1033907355 7:146221977-146221999 AAGTGTTTGTGAAAGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033907355 Original CRISPR AAGTGTTTGTGAAAGGAAGG AGG Intronic
No off target data available for this crispr