ID: 1033911616

View in Genome Browser
Species Human (GRCh38)
Location 7:146269951-146269973
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033911614_1033911616 22 Left 1033911614 7:146269906-146269928 CCTTTTTCACTCTTCAGTTTCAA 0: 1
1: 0
2: 2
3: 56
4: 539
Right 1033911616 7:146269951-146269973 CTGCTGTCTTTGTTAAACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr