ID: 1033911786

View in Genome Browser
Species Human (GRCh38)
Location 7:146272703-146272725
Sequence TTGTCCACACACACACATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033911786_1033911790 10 Left 1033911786 7:146272703-146272725 CCCTCATGTGTGTGTGTGGACAA 0: 1
1: 0
2: 1
3: 23
4: 267
Right 1033911790 7:146272736-146272758 GCAATAGATTGAGGAGTAAATGG 0: 1
1: 1
2: 2
3: 17
4: 222
1033911786_1033911791 19 Left 1033911786 7:146272703-146272725 CCCTCATGTGTGTGTGTGGACAA 0: 1
1: 0
2: 1
3: 23
4: 267
Right 1033911791 7:146272745-146272767 TGAGGAGTAAATGGTGACAAAGG 0: 1
1: 0
2: 1
3: 22
4: 224
1033911786_1033911789 1 Left 1033911786 7:146272703-146272725 CCCTCATGTGTGTGTGTGGACAA 0: 1
1: 0
2: 1
3: 23
4: 267
Right 1033911789 7:146272727-146272749 AAGTCAGAGGCAATAGATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033911786 Original CRISPR TTGTCCACACACACACATGA GGG (reversed) Intronic
904306772 1:29594924-29594946 TTGTCCACAGTCACACAGCAGGG - Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
913544538 1:119853919-119853941 TTTTCCAACCACACACAGGAGGG - Intergenic
913602271 1:120433459-120433481 TTTTCCAGCCACACACAGGAGGG + Intergenic
913991906 1:143620698-143620720 TTTTCCAACCACACACAAGAGGG - Intergenic
914084779 1:144443178-144443200 TTTTCCAGCCACACACAGGAGGG - Intronic
914190787 1:145408344-145408366 TTTTCCAGCCACACACAGGAGGG - Intergenic
914363443 1:146957065-146957087 TTTTCCAGCCACACACAGGAGGG + Intronic
914488234 1:148130069-148130091 TTTTCCAGCCACACACAGGAGGG - Intronic
914588596 1:149085189-149085211 TTTTCCAGCCACACACAGGAGGG - Intronic
914921671 1:151851770-151851792 GTGCACACACACACACAAGAAGG + Intronic
916881319 1:169022087-169022109 TTCCCCACACACACACAGGTTGG + Intergenic
917235251 1:172884773-172884795 TTGACCACACAAAAACATAAGGG - Intergenic
918296671 1:183163538-183163560 TCCTGCACACAGACACATGATGG + Intergenic
918600824 1:186358044-186358066 ATGTACACACACACAAATTAGGG + Intronic
918673566 1:187252824-187252846 TGGTGCACACACACACACAAAGG + Intergenic
921006644 1:211100344-211100366 TTATACACACACACACATTTTGG + Intronic
921553800 1:216571615-216571637 TGATCTACACACACACAGGAAGG - Intronic
922061413 1:222096280-222096302 AAGTCCACACACACAGACGAGGG - Intergenic
922202625 1:223419105-223419127 GTGCACAGACACACACATGAGGG + Intergenic
922403147 1:225281962-225281984 TCATACACACACACACACGACGG + Intronic
922506174 1:226127136-226127158 TTTTGAAAACACACACATGAGGG + Intergenic
922750242 1:228066873-228066895 TTGTCCACCCAAACACAGGCTGG + Intergenic
923454133 1:234148271-234148293 TTATCCACACGCACTCAAGATGG + Intronic
1063273427 10:4537530-4537552 GTGTGAACACACACACAAGAAGG + Intergenic
1064156943 10:12910065-12910087 TTGTCCACACAGCCACATCCAGG + Intronic
1064980100 10:21157881-21157903 TAGGACACAGACACACATGAAGG + Intronic
1068109149 10:52658459-52658481 ATGTACACACACACACACAATGG - Intergenic
1069318110 10:67133325-67133347 TTATACACACACACACACAATGG + Intronic
1070226783 10:74516181-74516203 TTGCCACCACAAACACATGAAGG - Intronic
1071058694 10:81543445-81543467 TCATACACACACACACATCATGG + Intergenic
1071264061 10:83948336-83948358 TTTTCCACACATACACAGGATGG + Intergenic
1074075391 10:110119033-110119055 TCTTCCACACACACACAAAAAGG - Intronic
1074590060 10:114804048-114804070 TTCTCCTCAGACACACAGGAGGG - Intergenic
1075604724 10:123796268-123796290 TTGTGGACACACACAAAAGAAGG + Intronic
1075832114 10:125420130-125420152 CTGTCCCCACACCCACATGCAGG - Intergenic
1076259871 10:129057074-129057096 ATGTGCACACACATACATGTGGG - Intergenic
1076631595 10:131855286-131855308 TGTGCCACACACACACAAGACGG + Intergenic
1076807512 10:132866466-132866488 TACTCCACACACACACATTGGGG + Intronic
1078376363 11:10796561-10796583 TTTTCCAAAAACACACACGAAGG - Intergenic
1078982090 11:16547424-16547446 ATGTACACACACACACACAATGG + Intronic
1079566851 11:21892934-21892956 TCCTCCACACACACACACAATGG + Intergenic
1079629578 11:22657519-22657541 TGGTGCACACACACACACGCAGG - Intronic
1081476768 11:43440916-43440938 TTGTCTACACACATACATACAGG - Intronic
1082669356 11:56015372-56015394 TTGTTCTGACACACACTTGAAGG - Intergenic
1082700030 11:56417647-56417669 CTGCTCAGACACACACATGAAGG - Exonic
1083121133 11:60512714-60512736 TTCTCCACACACACACCACAGGG + Intergenic
1083192512 11:61062443-61062465 TGGGCCACACACCCACATGTTGG - Intergenic
1085814962 11:79727788-79727810 CTGTCCACGCACATACATGCTGG + Intergenic
1086918854 11:92562850-92562872 CTGTCCACTCACACAGGTGAGGG + Intronic
1087389604 11:97516386-97516408 AGGTACACACCCACACATGATGG + Intergenic
1087557183 11:99735777-99735799 TTCTCTACACACACAAACGATGG - Intronic
1089108311 11:116033999-116034021 TTGTGCACACACACACACACAGG + Intergenic
1089500859 11:118930371-118930393 TTCCCCACCCACACACCTGAAGG - Intronic
1089544573 11:119213313-119213335 TTGTGTACACAAACACAGGAAGG - Intronic
1090711983 11:129395403-129395425 TTGTCCACAAACTCTCCTGAGGG + Intronic
1091224191 11:133947635-133947657 GTGGCCAGACACAGACATGAAGG - Intronic
1091253152 11:134160859-134160881 TTGTGAGCACACACACAGGATGG - Intronic
1092293307 12:7178449-7178471 TTGTCCCCACACAGAAAAGAAGG - Intergenic
1092342630 12:7689693-7689715 GTGTGCACACACACACATCCTGG - Intergenic
1094553835 12:31478246-31478268 GTGTCAACATACACACAAGATGG + Intronic
1095839741 12:46680034-46680056 GTGTACACACACACACAGGATGG + Intergenic
1096116121 12:49056281-49056303 GTTTCCACACACATACATGGGGG + Intronic
1096242797 12:49968220-49968242 ATGTCCTCATCCACACATGACGG - Intronic
1096690014 12:53314735-53314757 GTGTCCCCACACACACCTGCTGG + Exonic
1096925184 12:55136034-55136056 ATATCCACCCACACAGATGAGGG + Intergenic
1098737485 12:74125352-74125374 TTGTTAGCACACACACATTAAGG - Intergenic
1099026081 12:77466169-77466191 TTATCCAAACAAACACATAATGG - Intergenic
1099517930 12:83622114-83622136 TTTTACACACACACACATGAAGG - Intergenic
1099551294 12:84046692-84046714 GTATCCACACACACACACCATGG - Intergenic
1099648161 12:85387554-85387576 TTGACAGCACACACACATAAAGG + Intergenic
1103176336 12:118866676-118866698 GTGTGCACACACACACACGGTGG + Intergenic
1106621891 13:31378159-31378181 TTCACCACACAAACAAATGAAGG + Intergenic
1107442204 13:40438068-40438090 CACACCACACACACACATGAAGG - Intergenic
1109911116 13:68911668-68911690 ATATACACACACACACATCATGG + Intergenic
1110205032 13:72902018-72902040 GTGTGTATACACACACATGATGG + Intronic
1110982572 13:81919750-81919772 TTGTGCACACACTCACTTGAGGG + Intergenic
1110997968 13:82137709-82137731 ATGTACACGTACACACATGAGGG - Intergenic
1112195954 13:97226480-97226502 TTGTACACACACACAAAGGCAGG - Intronic
1114178773 14:20347339-20347361 ATATACACACACACATATGAAGG - Intronic
1115706811 14:36007639-36007661 TTGTACACAGACACACATGCAGG - Intergenic
1117340866 14:54790016-54790038 TGCTCCACACACACACAGGTGGG + Exonic
1118105636 14:62656362-62656384 TTGTACACAAAGACACATGAGGG + Intergenic
1118285814 14:64471072-64471094 GTCTCAACACACAGACATGAAGG - Exonic
1118855491 14:69618676-69618698 TTACACACACACACACAGGAGGG - Intronic
1119942874 14:78659694-78659716 TTGTCCTCACACACAAAAAATGG - Intronic
1121709763 14:96028900-96028922 TTGTCCATGCACACCCATCAGGG - Intergenic
1122730554 14:103794011-103794033 TTGTCCACAGACAGGCATGGAGG + Intronic
1126468334 15:48981176-48981198 ATGTGCATACACACAAATGAAGG - Intergenic
1128839480 15:70838299-70838321 TTGTCACAACACTCACATGAGGG - Intronic
1130576873 15:85100812-85100834 GTGTCTACACAGACACTTGACGG - Intronic
1132406130 15:101542763-101542785 CTGTCCTCACACACAGCTGAGGG + Intergenic
1133263095 16:4565038-4565060 TTGTCCACACGGTCACATGTGGG - Intronic
1134379827 16:13713510-13713532 ATGCACACACACACACATGCAGG + Intergenic
1135861212 16:26057835-26057857 TTCTTCACACAGACAGATGAAGG - Intronic
1135968401 16:27054218-27054240 TTGACTACATACTCACATGAGGG + Intergenic
1138830962 16:60374192-60374214 TTGTACACACAAACACATCACGG - Intergenic
1140566499 16:76049030-76049052 TTGCCAGCACACACACATGCAGG - Intergenic
1140605312 16:76529426-76529448 TTGTCCAGCCACAGAAATGATGG + Intronic
1142508890 17:382102-382124 TTGTCCAAAGACACACAGCAAGG - Intronic
1144199618 17:12928508-12928530 ATGTACACACACACACAGTATGG - Intronic
1144750314 17:17644065-17644087 TTGGACACACACACACATAGAGG + Intergenic
1146546506 17:33743357-33743379 TTAGCCACACCCACACATGATGG - Intronic
1148568195 17:48646336-48646358 TTCCCCACACACACACCTGTTGG + Intergenic
1148606484 17:48933171-48933193 TTGCACACACACACACTCGAAGG + Intronic
1149090934 17:52778122-52778144 TTATACACATACACACATGAAGG + Intergenic
1149165253 17:53743685-53743707 GTGTATACACAGACACATGATGG - Intergenic
1150507130 17:65710591-65710613 TTCTGCACACACAGACATGTTGG - Intronic
1151178626 17:72309721-72309743 TTGAGCAGACACCCACATGAAGG + Intergenic
1151520605 17:74626545-74626567 TTGTCCACACTCCCACACGATGG - Intergenic
1152204675 17:78968138-78968160 TTGGCCACCCACAGACATGCAGG + Intergenic
1153940608 18:9973573-9973595 GAGGCCACCCACACACATGAGGG - Intergenic
1157397392 18:47354284-47354306 TTGTCCTCATACTCCCATGATGG + Intergenic
1157397447 18:47354779-47354801 CTGTCCTCACATACACATGCAGG + Intergenic
1158397896 18:57094169-57094191 TTGTACTCTCAGACACATGAGGG - Intergenic
1159722731 18:71913385-71913407 GTCTCCACACACTCACCTGAAGG + Intergenic
1160074307 18:75657872-75657894 TTCTGCACTCACACACATCAAGG - Intergenic
1161726850 19:5934187-5934209 TTGCCAAGACACACAGATGAAGG - Intronic
1163294459 19:16403399-16403421 TGGTCCTCACACAAACAAGAGGG - Intronic
1163833450 19:19558984-19559006 GTGTCCACACACACAGAGGAGGG - Intergenic
1164807092 19:31125348-31125370 CTTTCCACACCCACACATAAGGG - Intergenic
1164882599 19:31746468-31746490 ATGTACACACACACACACAATGG + Intergenic
1166348187 19:42179660-42179682 TGTTTCTCACACACACATGAGGG - Intronic
1166634402 19:44436972-44436994 ATTTACACACACACAAATGAGGG + Intronic
1167967266 19:53158064-53158086 TGGTCCACACATTCACAGGAAGG + Intronic
1168116618 19:54224464-54224486 CTGTCCACACACACAGGGGAGGG - Intronic
1168119601 19:54244247-54244269 CTGTCCACACACACAGGGGAGGG - Intronic
1168126099 19:54284046-54284068 CTGTCCACAAACACAGAAGAGGG - Intergenic
1168168619 19:54572178-54572200 CTGTCCACACACACAGGGGAGGG + Intergenic
1168175837 19:54627031-54627053 CTGTCCACAAACACAGAAGAGGG + Intronic
1168484303 19:56747947-56747969 TCGCACACACACACACACGATGG - Intergenic
925131532 2:1497215-1497237 TTGTCCACACCTAAACATGCGGG - Intronic
925778069 2:7354528-7354550 TAGGGCACAGACACACATGAAGG - Intergenic
926130543 2:10301315-10301337 CTGTCCACAGACTCACAGGAAGG - Intergenic
926834305 2:17000598-17000620 GTGGCCACACACATACATGAGGG + Intergenic
929127634 2:38535856-38535878 TTATGTACACACATACATGAAGG + Intergenic
931115917 2:59166628-59166650 TTGCACACAGACACACAGGAAGG + Intergenic
931324157 2:61201131-61201153 TTCTCAACACTCACAAATGATGG + Intronic
934678894 2:96268411-96268433 TGGGCCACACAGACACATGTTGG + Intronic
935290883 2:101610142-101610164 TAGGCCACACACACACAGGAAGG + Intergenic
935457066 2:103282433-103282455 TTCTCTACAAACACACCTGAGGG - Intergenic
935633652 2:105232930-105232952 CTGACCACAAACAGACATGAAGG + Intergenic
936065455 2:109328748-109328770 TGGTTCACACACACAAATGTGGG - Intronic
938295376 2:130175138-130175160 TGGGCCACTGACACACATGAGGG - Intronic
938461244 2:131498690-131498712 TGGGCCACTGACACACATGAGGG + Intergenic
938859749 2:135355755-135355777 TTGTCCACACACAAAAAATAGGG - Intronic
939422957 2:141997372-141997394 ATGTACACACACACACATCTTGG - Intronic
942806505 2:179937302-179937324 TTGTCCTCACAAAAACAAGAGGG + Intergenic
943718239 2:191175789-191175811 TTGTGGACAAACACAGATGAGGG + Intergenic
944172536 2:196795690-196795712 TTTTCCACAAACACAGTTGATGG + Intronic
944753464 2:202735172-202735194 AAGTCCACACACACACAAAATGG - Intronic
945220143 2:207475053-207475075 TTGTCTACACAAACACAGAATGG - Intergenic
945463899 2:210144983-210145005 GTGTCCTCACACCCACCTGAAGG - Intronic
945820053 2:214652902-214652924 TTTTGCACACACACACAAAAAGG + Intergenic
947282046 2:228465959-228465981 CTTTCCACACACACACACAAAGG - Intergenic
947492906 2:230611226-230611248 TTCTCCACACACACCCTTCAAGG + Intergenic
948275408 2:236704453-236704475 CTGTACACACACACACAGAATGG + Intergenic
1170505369 20:17020379-17020401 TAGTGCACACACACTTATGATGG + Intergenic
1172614791 20:36275862-36275884 GTGTGCACACACACATGTGAGGG - Intergenic
1172867858 20:38113565-38113587 CTCTCCACACACAAACTTGAGGG - Intronic
1174802798 20:53579055-53579077 TTGTCCACAAACACTCATGTGGG + Intronic
1179516195 21:41908826-41908848 GTGTACACACACACACATACAGG + Intronic
1179566506 21:42252404-42252426 CCGTCCACACACAGACATTAAGG - Intronic
1180048658 21:45321286-45321308 TGATCCCCACCCACACATGAGGG - Intergenic
1180171205 21:46059352-46059374 CTGTCCACACACACACACTGAGG - Intergenic
1180220172 21:46353585-46353607 ATGCACACACACACACATGCTGG - Intronic
1181048966 22:20229774-20229796 ATGTGGACACACACACATGGGGG + Intergenic
1181114714 22:20624321-20624343 TGGGCCACTGACACACATGAGGG - Intergenic
1181307885 22:21927301-21927323 GTGCCCACACACACGCGTGAAGG + Intronic
1182199835 22:28557039-28557061 TTGTCCTCACTCACACTTAATGG - Intronic
950408794 3:12820894-12820916 TTGTCCACACTCACACACCCAGG - Intronic
950856142 3:16107198-16107220 TTCTCCACACACACACACAGAGG - Intergenic
951260136 3:20497432-20497454 TTGGGTACACACAAACATGAAGG - Intergenic
954366322 3:50148044-50148066 GTGGCCACACAGACACATGGAGG + Intergenic
954899182 3:54004377-54004399 TGATCCTCACACACACTTGATGG - Intergenic
955675030 3:61439152-61439174 GTGTACACAAAGACACATGAGGG + Intergenic
955691504 3:61595059-61595081 TTGTCAAAACACACAGATGACGG + Intronic
956057512 3:65315967-65315989 ATGTGCACACAAACACATAAGGG + Intergenic
959902274 3:111674495-111674517 CTGTCTACACACACACTGGAAGG + Intergenic
960307687 3:116082098-116082120 TTGTATTCATACACACATGAAGG + Intronic
961947901 3:130713332-130713354 TTTTCCACTCAGACAAATGAGGG + Intronic
963262062 3:143202754-143202776 TTATACACACACACAAAAGAAGG - Intergenic
963505601 3:146180931-146180953 TTTGTTACACACACACATGAGGG + Intergenic
963963988 3:151344902-151344924 TTGTCAACACATACACATTTTGG + Intronic
965470559 3:169085153-169085175 TTTGCCAAACACACCCATGAAGG - Intronic
966577762 3:181522125-181522147 TTCTCCACATACACACATCATGG - Intergenic
968354570 3:198094279-198094301 TTGTACACACGCACACATTCTGG - Intergenic
969261163 4:6034901-6034923 TGAACCACACACACACATTATGG - Intronic
971047318 4:22819474-22819496 TTGTCCAAACACACAAAATATGG - Intergenic
971421585 4:26478180-26478202 CTCTCCCCACACACACATCAAGG + Intergenic
971694967 4:29889081-29889103 ATATACACACACACATATGATGG + Intergenic
972413795 4:38819040-38819062 TGGGCCACACACACACAAAAAGG + Intronic
974376214 4:61080014-61080036 ATGTACACACACACACACCATGG + Intergenic
976073824 4:81273689-81273711 CTGGCCACACAAACACTTGAGGG + Intergenic
976364516 4:84218227-84218249 TAGTCGACACTCACACAAGAGGG + Intergenic
976916572 4:90383593-90383615 AAGGCCACACACACACACGAAGG + Intronic
977351067 4:95888244-95888266 TTATACACATACATACATGAAGG - Intergenic
980462513 4:133134711-133134733 CTATACACACACACAAATGAAGG + Intergenic
982084781 4:151823296-151823318 GTGTGCACACATACACATGTGGG - Intergenic
982604555 4:157497745-157497767 TTGTGCACACACACACAAAGAGG - Intergenic
982992307 4:162293432-162293454 ATGTACACACACACACACCATGG + Intergenic
985126821 4:186702721-186702743 TATTCCACACACCCACAAGAGGG + Intronic
985194551 4:187414647-187414669 AGGACCACACACACACATGCGGG + Intergenic
985509883 5:307448-307470 GTGTGCACACACACATGTGACGG + Intronic
988008412 5:25449830-25449852 TTGTCCACAAACTCACAGAATGG + Intergenic
988188204 5:27895504-27895526 TTGTTTACACACACAAATGATGG + Intergenic
988266356 5:28955756-28955778 AAATCCACACACACACATGCTGG - Intergenic
988415933 5:30947214-30947236 ATGTGCACACAGACACATGATGG + Intergenic
988783248 5:34542612-34542634 TAGTCCACACGCACACAAAAAGG - Intergenic
989276194 5:39592569-39592591 TAATCCACATACACACAGGAAGG + Intergenic
990818066 5:59807496-59807518 TTGTCCCCACACACACACAGAGG + Intronic
991519644 5:67481485-67481507 CTGTTCACACAGAGACATGATGG - Intergenic
993180203 5:84542855-84542877 GTGTGCGCACACACACATGCTGG + Intergenic
998712150 5:144838971-144838993 TTGTACACACACAAACATACAGG + Intergenic
999387852 5:151167803-151167825 TAGGACACAAACACACATGAGGG + Intergenic
1001566420 5:172702286-172702308 TTGTCCACGCAGCCACAGGAGGG + Intergenic
1001578093 5:172778091-172778113 TTGTCCAAAGACACACAGTAAGG + Intergenic
1004067232 6:12260443-12260465 TTTACCACTCACAGACATGAAGG - Intergenic
1004601032 6:17150153-17150175 CTGTCCTCACACAGGCATGACGG + Intergenic
1005726219 6:28651275-28651297 TTGAACATACACACACATGCAGG + Intergenic
1007417683 6:41701588-41701610 TCATCCACACAAACACTTGATGG + Intronic
1008856199 6:56090457-56090479 TTGACCTCACACACAAATGTTGG - Intronic
1010769722 6:79814494-79814516 TTTTCCACTCACACAGATAATGG + Intergenic
1011507243 6:88059251-88059273 TTGTCCACAGTCACACAGGCAGG + Intronic
1014281658 6:119448357-119448379 TTGTGTACACACACACTTAATGG + Intergenic
1014334473 6:120115737-120115759 ATGTACACACAAACACATCATGG - Intergenic
1015603969 6:134937052-134937074 TGCTCCACACACACACCTAATGG + Intronic
1016903452 6:149125458-149125480 GTATCCACACACACACACAATGG + Intergenic
1018328639 6:162703759-162703781 TAGTCCACACACACACTGGTTGG + Intronic
1019052854 6:169197074-169197096 ATGTGCACACACACACACCATGG + Intergenic
1019914572 7:4124458-4124480 TTGTCCACAGACACACAACAGGG - Intronic
1020105166 7:5419463-5419485 ATGCACACACACACACATCACGG + Intronic
1020736026 7:11950282-11950304 TTGCCTGCACACACACATGTCGG + Intergenic
1022149935 7:27591905-27591927 TTGACAAGACACTCACATGAAGG - Intronic
1023903214 7:44501144-44501166 TTGTACACACACACACACAGTGG + Intergenic
1024532114 7:50401904-50401926 GTGTCCACACATACATAGGATGG + Exonic
1026268279 7:68814243-68814265 TTTTACACACACACAAATTATGG + Intergenic
1028977741 7:96933006-96933028 TTGTCCACAAACAGAGATTATGG + Intergenic
1033619676 7:143050850-143050872 ATCTTCACACACACACATGCTGG + Intergenic
1033911786 7:146272703-146272725 TTGTCCACACACACACATGAGGG - Intronic
1035263952 7:157679068-157679090 ATGTACACACACACACACTAAGG - Intronic
1035777204 8:2197076-2197098 GTCCCCACATACACACATGAGGG - Intergenic
1035910670 8:3562463-3562485 ATATGCACACACACACATTAAGG + Intronic
1036504108 8:9339621-9339643 TTGTAAACACACACAGAAGATGG + Intergenic
1037020701 8:13966658-13966680 TTTTACAACCACACACATGATGG - Intergenic
1037309008 8:17535471-17535493 TTGCACAGACACACAGATGATGG - Intronic
1037899948 8:22682241-22682263 TTGTCCAAACTCACACATCTAGG - Intergenic
1039087167 8:33791469-33791491 ATATACACACACACACATCATGG + Intergenic
1041289934 8:56299034-56299056 CTCTCCACACACACACACCAAGG + Intergenic
1041439151 8:57875030-57875052 GTGTCCACAGACACATATGAGGG + Intergenic
1043249126 8:78047807-78047829 TTTTACACACACACACATAATGG + Intergenic
1043824074 8:84903512-84903534 CTGAACACACACACATATGAGGG + Intronic
1046015230 8:108597094-108597116 TTGTACACAAACACACAAAAAGG - Intergenic
1046021713 8:108673219-108673241 TTATCCTCACACACAGATCATGG + Intronic
1046344956 8:112911614-112911636 ATGTACACACACACACACAATGG - Intronic
1049104341 8:140602143-140602165 TTTTCCACATGAACACATGAGGG + Intronic
1050565725 9:6880738-6880760 TTGTCTACACACACAAAAGCAGG - Intronic
1050840745 9:10145704-10145726 TTATACACATACACACATGCTGG - Intronic
1051139694 9:13965066-13965088 GTGCACACACACACACATTAGGG + Intergenic
1051207032 9:14698952-14698974 TTGTTCACTCCCATACATGAAGG + Intergenic
1051737958 9:20221884-20221906 TTGCCCACAGACACTCAGGAAGG + Intergenic
1051897018 9:21997439-21997461 ATGTCTACACACACATATGTGGG + Intronic
1052566606 9:30161042-30161064 GTATGCACACACACACATGCAGG - Intergenic
1053800433 9:41760618-41760640 TTATCCACAAACACACCTGTGGG - Intergenic
1054144761 9:61554217-61554239 TTATCCACAAACACACCTGTGGG + Intergenic
1054188862 9:61972770-61972792 TTATCCACAAACACACCTGTGGG - Intergenic
1054649658 9:67615847-67615869 TTATCCACAAACACACCTGTGGG + Intergenic
1054893022 9:70272542-70272564 ATCTCCACACACACACAAAAAGG + Intronic
1054965909 9:71026549-71026571 GTGCACACGCACACACATGATGG - Intronic
1055242874 9:74205366-74205388 CTGTCCTCACACACCCATGAAGG - Intergenic
1056755746 9:89381120-89381142 TTATTCACCCACACACATGGGGG + Intronic
1058107805 9:100993187-100993209 ATATACACACACACACAAGATGG + Intergenic
1059349743 9:113656213-113656235 TTGTGCACACACACACACAATGG - Intergenic
1059699053 9:116757578-116757600 TTGTCCACATACACAGATGGGGG - Intronic
1060192755 9:121603489-121603511 CTGCCCACATACACACATTAGGG - Intronic
1060693024 9:125681620-125681642 TTCTCCACGGACACACCTGAAGG + Intronic
1060973887 9:127754024-127754046 TGGTCCTCCCACACACCTGAGGG + Intronic
1061258931 9:129468699-129468721 CTGTCCACACACACACACACAGG - Intergenic
1061258944 9:129468897-129468919 CTGTCCACACACACACACACAGG - Intergenic
1061258953 9:129469061-129469083 CTGTCCACACACACACACACAGG - Intergenic
1185916981 X:4046593-4046615 CTGTCCACCCACCCACATGTAGG - Intergenic
1185956459 X:4496150-4496172 TTGGCCACACAGTCACATTATGG - Intergenic
1187452753 X:19413184-19413206 ATGCCCACACACACACAAAATGG + Intronic
1188801270 X:34533217-34533239 TAGAACACACACACACATCAGGG + Intergenic
1189928312 X:45981002-45981024 TTGTTCACTCACACATCTGATGG + Intergenic
1194938714 X:99983237-99983259 TTCTTCACACAGAGACATGAAGG + Intergenic
1195700296 X:107700361-107700383 TTGTTGTCACACACACATGTTGG - Intergenic
1198506320 X:137304458-137304480 TTGTCCACAGTCACACATCCTGG - Intergenic
1199692593 X:150319993-150320015 TTGGCCACACACACACACACAGG - Intergenic
1199999814 X:153054003-153054025 TGGTACACACACACACACAATGG + Intergenic
1201061478 Y:10050555-10050577 TCCACCACACACAGACATGAGGG + Intergenic
1202035145 Y:20625540-20625562 TCCTCCACACACACACACAAAGG - Intergenic