ID: 1033918382

View in Genome Browser
Species Human (GRCh38)
Location 7:146356716-146356738
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033918378_1033918382 8 Left 1033918378 7:146356685-146356707 CCTAACTGAGCAGTTAGAGATTT 0: 1
1: 0
2: 0
3: 15
4: 136
Right 1033918382 7:146356716-146356738 TTGGATGGAGAAGTGGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr