ID: 1033921612

View in Genome Browser
Species Human (GRCh38)
Location 7:146400034-146400056
Sequence GAGGGTTCTCTTACCAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 110}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033921612_1033921623 18 Left 1033921612 7:146400034-146400056 CCAGTTTTGGTAAGAGAACCCTC 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1033921623 7:146400075-146400097 TGGGCTAGGTATGGTTCCTGAGG No data
1033921612_1033921618 4 Left 1033921612 7:146400034-146400056 CCAGTTTTGGTAAGAGAACCCTC 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1033921618 7:146400061-146400083 CTTTTTACCTTCCCTGGGCTAGG No data
1033921612_1033921615 -2 Left 1033921612 7:146400034-146400056 CCAGTTTTGGTAAGAGAACCCTC 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1033921615 7:146400055-146400077 TCTTGCCTTTTTACCTTCCCTGG 0: 1
1: 2
2: 1
3: 37
4: 294
1033921612_1033921616 -1 Left 1033921612 7:146400034-146400056 CCAGTTTTGGTAAGAGAACCCTC 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1033921616 7:146400056-146400078 CTTGCCTTTTTACCTTCCCTGGG No data
1033921612_1033921619 9 Left 1033921612 7:146400034-146400056 CCAGTTTTGGTAAGAGAACCCTC 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1033921619 7:146400066-146400088 TACCTTCCCTGGGCTAGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033921612 Original CRISPR GAGGGTTCTCTTACCAAAAC TGG (reversed) Intronic
904818721 1:33226100-33226122 CAGGGTTCTTTTACCAAGAAAGG + Intergenic
904826075 1:33274607-33274629 GAGGGTGCTCTGACCCAAACTGG + Intronic
905845323 1:41225873-41225895 GATGGTTCTTTGACCAAAAAAGG - Intronic
914687487 1:149993794-149993816 GTGGTTGATCTTACCAAAACTGG + Intronic
917566189 1:176214313-176214335 GAGGGTTGCCTTGCCAAATCTGG + Intergenic
917584467 1:176412040-176412062 GATGGTACTGGTACCAAAACAGG - Intergenic
917584471 1:176412062-176412084 GATGGTACTGGTACCAAAACAGG - Intergenic
920430276 1:205914428-205914450 GAGGGTGCTAGTACCAACACAGG - Exonic
921277634 1:213535569-213535591 GAGTTTTCTCTTAATAAAACAGG + Intergenic
922816856 1:228455349-228455371 GAGTTTTCTCTTACCAAAGCAGG + Intergenic
924653015 1:245948023-245948045 CAGGGTTCTTTTGCTAAAACTGG - Intronic
1063620030 10:7638001-7638023 GAGGGTTCTCTTATTCAAAATGG + Intronic
1063844697 10:10113251-10113273 GAGGTTTCTCTGATCAAAAATGG - Intergenic
1066931732 10:41770136-41770158 GATGTTTCTCTTTCCAACACAGG - Intergenic
1067482287 10:46610244-46610266 GAGGGTTCTGTGACCAAGAAAGG - Intergenic
1067612462 10:47731424-47731446 GAGGGTTCTGTGACCAAGAAAGG + Intergenic
1071627881 10:87191671-87191693 GAGGGTTCTGTGACCAAGAAAGG + Intergenic
1081734098 11:45391465-45391487 GAGAGTTCTCCTACCAAAGGAGG - Intergenic
1087186686 11:95206456-95206478 GAGAATTTTCTTGCCAAAACAGG - Intronic
1089118399 11:116114321-116114343 GGGGGTGCCCTGACCAAAACTGG - Intergenic
1089907747 11:122061265-122061287 GAATGTTCTCTGACCACAACAGG + Intergenic
1093532771 12:20186950-20186972 CAGAGTTTTGTTACCAAAACAGG + Intergenic
1094589574 12:31807867-31807889 CAGGGTTCTATTACAAAAAATGG + Intergenic
1099022093 12:77418958-77418980 GAGGGTTCTCTTATGATAAATGG - Intergenic
1100786413 12:98083201-98083223 AAGGGTTCTGTTAGCAAAATAGG - Intergenic
1101692452 12:107094178-107094200 TAGGGTTCTCTGGCCAAAGCAGG - Intergenic
1105625421 13:22107781-22107803 GAGAGTTCTCAAACCAACACTGG - Intergenic
1106188706 13:27431252-27431274 GAGGCTACAGTTACCAAAACAGG - Intronic
1110091003 13:71447998-71448020 GAGGGAGTTCTTCCCAAAACTGG - Intronic
1110309871 13:74036595-74036617 GAGGCTTTTCTTTGCAAAACAGG + Intronic
1112110254 13:96289651-96289673 GAGAGCTTTCTAACCAAAACAGG + Intronic
1113307929 13:109098130-109098152 GAAGGTTCTCTCTCCAAACCAGG - Intronic
1114167707 14:20238617-20238639 GTGCGTTCTCTTTCCAACACTGG - Intergenic
1114834530 14:26188004-26188026 GGGGGTACTCTTACTAAAGCTGG + Intergenic
1117443135 14:55778630-55778652 TAGGGTTCTCTGCCCAAAAAAGG - Intergenic
1130037040 15:80370317-80370339 GAGGGTTTTTTTCCCAAAACGGG - Intronic
1134296187 16:12947895-12947917 GTGGGTTCTGTTGCCAAACCTGG + Intronic
1135140357 16:19916064-19916086 CAGGGTTTTATTACCAAAAAGGG - Intergenic
1135642087 16:24128587-24128609 AAGGGCTATCTTACCAAAGCAGG + Intronic
1143607115 17:7993769-7993791 GAAGGTTCTCTTCCCAAAGAGGG - Intergenic
1149376034 17:56045123-56045145 GAGGGTCCCCTTGTCAAAACCGG + Intergenic
1149702610 17:58667995-58668017 CAGGGTTCCTTTACTAAAACTGG - Intronic
1159081277 18:63738848-63738870 GAGGGTTCTCTTCCTAAGATAGG + Intergenic
1161176356 19:2844678-2844700 GAGGGTTCTCATCCCAATAGAGG - Intronic
1165822134 19:38683375-38683397 GAGGGCTCTCTAACCCAGACAGG + Intronic
1166605799 19:44141697-44141719 GAGGCTTCTTTTCCCATAACCGG - Exonic
1167825425 19:51968564-51968586 GTGGGTTCTCTCACCTGAACAGG + Exonic
929320347 2:40536327-40536349 GAGTGTTTTATTACCAAAAGAGG + Intronic
929784768 2:44981434-44981456 GAGGGTCCTCTTCCCAGACCAGG - Intergenic
930577884 2:53174082-53174104 GAGGTTTGTCTTAGAAAAACAGG - Intergenic
930898041 2:56468901-56468923 CAGGGTACTCATACAAAAACAGG + Intergenic
931715000 2:65021858-65021880 GAGGGTTCTCTAATCTAATCAGG + Exonic
932954850 2:76339120-76339142 AAGGGTTCTATTACCAAAATAGG - Intergenic
933722374 2:85406406-85406428 CAGGGTTCTTTTGCTAAAACCGG - Intronic
938216144 2:129517937-129517959 CATGGTTCTGTTACAAAAACAGG - Intergenic
939637028 2:144594608-144594630 GAGGATTATCTTCCCAAAACAGG - Intergenic
942481418 2:176392578-176392600 GAGTGTGCTCTTACCAGTACAGG + Intergenic
948433460 2:237935783-237935805 GAGGGTTCTTTTGCTAAAACTGG - Intergenic
1176431580 21:6579404-6579426 GAGGCTTCTGTTTCCAAAGCAGG + Intergenic
1176451563 21:6866674-6866696 CATGGTACTGTTACCAAAACAGG + Intergenic
1176829731 21:13731725-13731747 CATGGTACTGTTACCAAAACAGG + Intergenic
1178737141 21:35162411-35162433 GAAGGTTCTTTGACCAAAGCAGG - Intronic
1179706974 21:43186866-43186888 GAGGCTTCTGTTTCCAAAGCAGG + Intergenic
1181716377 22:24732972-24732994 GGGGCTTCTCTTACCAAGAGGGG + Intronic
952996364 3:38886737-38886759 GAGAGTTTCCTTAGCAAAACAGG + Intronic
954612737 3:51954762-51954784 CAGGGTGCTGTTACCAAAAGGGG + Intergenic
957293847 3:78311081-78311103 GCGGCTTCTTTTACCAAAGCTGG - Intergenic
957751956 3:84431673-84431695 GAAGGTACTCTTACCAAATAGGG - Intergenic
959929680 3:111965994-111966016 GGGGGTACTCTTCACAAAACTGG + Intronic
963138363 3:141928424-141928446 CAGGGTTCTCTTACCCAGACAGG - Intergenic
963508528 3:146218762-146218784 GAGCGTTGTCCTACCAATACTGG + Intronic
965463120 3:168993482-168993504 CAGGGTTCTTTTGCTAAAACTGG - Intergenic
965681857 3:171260007-171260029 CAGGGTTCTTTTGCTAAAACTGG - Intronic
965876708 3:173331878-173331900 GATGTTTCCCTTCCCAAAACTGG + Intergenic
969567509 4:7987476-7987498 GGGGGTTCCCTGACCAGAACAGG - Intronic
972694110 4:41427748-41427770 TAAGGTTATCTTACCAAAACAGG + Intronic
977828172 4:101557966-101557988 CATGGTACTGTTACCAAAACAGG - Intronic
979606740 4:122646260-122646282 GATGGTACTCTGACCAATACAGG + Intergenic
983013712 4:162582301-162582323 GAGTCTTCTCTTCCCAAAACAGG - Intergenic
985839109 5:2292265-2292287 GATGGTACTGGTACCAAAACAGG - Intergenic
988546887 5:32166429-32166451 CAGGTTTCTCTTATCAAAGCTGG - Intronic
989818254 5:45762928-45762950 GATGGTACTGGTACCAAAACAGG - Intergenic
990671352 5:58133574-58133596 GATTCTTCTTTTACCAAAACAGG - Intergenic
990908371 5:60827821-60827843 GTGGGTTGTGGTACCAAAACTGG - Intronic
990996224 5:61734622-61734644 GAGGTTTTTCTTGCCAGAACAGG - Intronic
991571202 5:68055108-68055130 CAGGCTCCTCTTATCAAAACAGG + Intergenic
993422443 5:87719179-87719201 GAGGGTTTTTTTCCCAAAATGGG + Intergenic
995087737 5:108134556-108134578 CAGAGTTCTCTTTCCAAAATGGG + Intronic
1001658232 5:173370608-173370630 CAGGGTGCTGTTACCAAAAACGG - Intergenic
1002948451 6:1785144-1785166 GAGAGTTATATTACCTAAACAGG + Intronic
1004585455 6:16995243-16995265 CAGTGTTCTCTTTCAAAAACAGG + Intergenic
1005065279 6:21811845-21811867 GAGATTTTTCTTACCAAAAAAGG + Intergenic
1005119435 6:22373518-22373540 GAGGGTTTTTTCCCCAAAACGGG - Intergenic
1008422991 6:51324383-51324405 AAGTGTTTTCTTATCAAAACAGG + Intergenic
1010719140 6:79262681-79262703 GAGGTTTTTTTTCCCAAAACAGG + Intergenic
1011257127 6:85434187-85434209 GATGGTACTATTACAAAAACAGG - Intergenic
1016066893 6:139692872-139692894 GAGGGATCTCATAACATAACAGG - Intergenic
1017380233 6:153820266-153820288 GAGGGCACTTCTACCAAAACAGG - Intergenic
1024122633 7:46260601-46260623 GAGGCTTTTCTTACCAACCCTGG - Intergenic
1027356944 7:77366593-77366615 TATGGTACTGTTACCAAAACAGG - Intronic
1031619807 7:123922626-123922648 GAATGTTCTCTTCCTAAAACAGG + Intergenic
1033921612 7:146400034-146400056 GAGGGTTCTCTTACCAAAACTGG - Intronic
1033993001 7:147311119-147311141 CAGGGTTCTTTTGCTAAAACTGG + Intronic
1034116168 7:148585762-148585784 GAAGGTGCTATTACCAAAAAAGG + Intergenic
1038504153 8:28070117-28070139 GAGCCCTCTCTTTCCAAAACAGG + Intronic
1041020963 8:53638042-53638064 CAGGGTACTGGTACCAAAACAGG - Intergenic
1048633601 8:136271518-136271540 GGGGGTTCAATTACCAGAACTGG - Intergenic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1056238552 9:84620352-84620374 CAGGGTTCACTTAGCAGAACTGG - Intergenic
1059350318 9:113659650-113659672 CAGGGTTCTTTTTCTAAAACTGG + Intergenic
1059587943 9:115626563-115626585 AAGGGTTCTCCTACCCTAACTGG - Intergenic
1059690193 9:116677304-116677326 GAGGTTTTTTTTTCCAAAACAGG - Intronic
1059970468 9:119662499-119662521 GAGGTTTCACTTACCCACACTGG - Intergenic
1060879573 9:127108603-127108625 GAGAGTTCATTTACCTAAACAGG - Exonic
1203517618 Un_GL000213v1:17843-17865 CATGGTACTGTTACCAAAACAGG - Intergenic
1186406163 X:9305369-9305391 GAAGGTTCTCTCACCATAGCAGG + Intergenic
1192614238 X:72601596-72601618 CAGGGTTCTCTTGCTAAAGCTGG + Intronic
1193166810 X:78290324-78290346 CATGGTTCTGGTACCAAAACAGG - Intronic
1195505531 X:105652191-105652213 GTAGGTTCTTTTACCAAGACAGG - Intronic
1198522075 X:137463159-137463181 GAGAGTTTTCTTTCCAAAGCTGG - Intergenic