ID: 1033922283

View in Genome Browser
Species Human (GRCh38)
Location 7:146409032-146409054
Sequence CCTACAACTTAGAATATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033922283 Original CRISPR CCTACAACTTAGAATATGGT AGG Intronic
909987654 1:82182616-82182638 TGTACAACATAGAATATGATAGG + Intergenic
911097703 1:94068609-94068631 CTTGCAAGTTAGAATATAGTAGG + Intronic
911433667 1:97825944-97825966 ACAACAATTTAGTATATGGTGGG - Intronic
912143857 1:106767140-106767162 CAAACAAGTTAGAATATGGTAGG + Intergenic
912972042 1:114292802-114292824 CCTTCAACTTAGGAAATGGATGG - Intergenic
919403037 1:197144164-197144186 TATACAACTTACAATATAGTAGG + Intronic
920069819 1:203294747-203294769 CCTTCCACTAAGAATAAGGTTGG - Intergenic
920688685 1:208129379-208129401 GCTACAACATAGAACTTGGTAGG - Intronic
920812497 1:209300006-209300028 CCTAGCACTTAGCATATGGCAGG + Intergenic
921223908 1:212997930-212997952 CCTAGAACTTAGAAGATGTTTGG - Intronic
923041750 1:230324620-230324642 CTTACCACTTAGAACAGGGTTGG - Intronic
1063951865 10:11230679-11230701 CCCACAATTTAGAGGATGGTTGG - Intronic
1065319437 10:24495469-24495491 CCTAGAACTTAGAATTCAGTGGG + Intronic
1067536056 10:47111021-47111043 CATAGAACCTGGAATATGGTTGG + Intergenic
1070415857 10:76188614-76188636 CATACAACTGAGAAGATGGAGGG + Intronic
1070988709 10:80712233-80712255 CCCTCAACTTACAATATGTTGGG - Intergenic
1073241622 10:102062638-102062660 CCTACTTCTTAGTATTTGGTGGG + Intergenic
1074586679 10:114774612-114774634 CCTACAACTGAGAAAAAAGTTGG + Intergenic
1076146110 10:128124277-128124299 CTTACAACTGAGAATTTGTTTGG + Intronic
1078822235 11:14893829-14893851 CCTAGAACTGTGAATATGTTAGG - Intergenic
1081355606 11:42108910-42108932 CCTACAGGGGAGAATATGGTAGG + Intergenic
1081880552 11:46447074-46447096 CCTACAACTTACAGGATTGTTGG + Intronic
1082823093 11:57558031-57558053 CCTAGAACTTAGAAGGTAGTGGG - Intronic
1087107483 11:94424529-94424551 CATACAATTTAGAATCTGGATGG + Intronic
1088022906 11:105141374-105141396 CATACAACTTCTAATAGGGTAGG - Intergenic
1088170712 11:106993106-106993128 TCTACAATATAGAAGATGGTTGG + Intronic
1089795926 11:120980799-120980821 CCTACAACTGAAAATCTGCTTGG - Intronic
1090917096 11:131175012-131175034 CCTACAACATAGAATACACTTGG - Intergenic
1092074567 12:5662319-5662341 CCTACAACTTAAGAGATGGTTGG + Intronic
1099467765 12:83008065-83008087 CCTACAAGTTTGAATATATTAGG + Intronic
1100414411 12:94356788-94356810 CTTACAATTTAAAATTTGGTGGG + Intronic
1100858864 12:98783692-98783714 CCTAGAAATGAGAATGTGGTGGG + Intronic
1102688648 12:114743553-114743575 CCTAGAACTTGGAATATGTTAGG - Intergenic
1103299937 12:119919120-119919142 CCCACATCTCAGAATATGGGCGG + Intergenic
1104544144 12:129695958-129695980 CCTGCAACTTAGAATATCACTGG + Intronic
1109588932 13:64449684-64449706 CATAGAACTCAAAATATGGTTGG + Intergenic
1112724368 13:102285744-102285766 CTTACAACTTACAATAGGGTAGG + Intronic
1112755460 13:102627729-102627751 CTTATAAATTAGAATATGATTGG + Intronic
1119808424 14:77497866-77497888 CCTACAGCTTAGTACATGGAAGG + Intronic
1120107730 14:80515778-80515800 CCTACAGCTGAGAATGTGCTGGG + Intronic
1122559885 14:102605331-102605353 TTCACAACTTAGAATATAGTTGG + Intronic
1124068113 15:26365016-26365038 CCTACACCTGGGAATATGGAGGG - Intergenic
1128599556 15:68984247-68984269 TCTCTAACTTAGAATATGGTGGG - Intronic
1129442335 15:75590666-75590688 CCTAGAACCTAGAACATAGTAGG + Intergenic
1129583043 15:76832159-76832181 CCTACAACTCAGAATCTGGATGG + Intronic
1130830193 15:87591423-87591445 CCTACAACTAATTATATGGTAGG + Intergenic
1131289608 15:91095306-91095328 CCTACAATTTAGGAAATTGTAGG - Intergenic
1131875160 15:96798174-96798196 CCTACAACTTTGAATAGTGATGG - Intergenic
1133231977 16:4371191-4371213 CCTTCATCTCATAATATGGTGGG + Intronic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1138749766 16:59405173-59405195 CTTACAACTCAGAATGAGGTAGG + Intergenic
1140783604 16:78318593-78318615 TCTACAACTGAGAAAATGGAAGG - Intronic
1149797872 17:59538067-59538089 GCTAGAGCTTAGAATAGGGTGGG - Intergenic
1159402536 18:67956485-67956507 CCTAAAATTTAGAATTTGGCTGG + Intergenic
1163911694 19:20200578-20200600 CCTACACCTTTGAGTAAGGTGGG - Intergenic
1164642462 19:29836470-29836492 CCTACAGCTTAGAAGAGGGATGG - Intergenic
1166407648 19:42532573-42532595 CCGAAAACTTACTATATGGTGGG + Intronic
930842007 2:55857533-55857555 CAAAAAACTTACAATATGGTGGG - Intergenic
932137828 2:69245969-69245991 CCTACAACTTTGGAAATGCTGGG + Exonic
935113360 2:100112252-100112274 ACTACAAATTAGAAGAAGGTGGG - Intronic
938827653 2:135022170-135022192 CATACAGCTTAAAATTTGGTGGG - Intronic
940787339 2:157995734-157995756 CTTACAAAATAGAAAATGGTGGG + Intronic
941557071 2:166994576-166994598 TCTTCAAATTACAATATGGTAGG + Intronic
942656801 2:178222267-178222289 TCTACAAATTAGAATATAGAAGG - Intronic
944891734 2:204124495-204124517 CCAACAACTTGACATATGGTTGG + Intergenic
946792726 2:223317839-223317861 CATACAAATTAGCATATGCTTGG + Intergenic
1170668379 20:18406604-18406626 ACTACAACTTGGAATGTGCTGGG - Intronic
1173736466 20:45365019-45365041 ACTACAACTAGGCATATGGTGGG - Intronic
1183023699 22:35048000-35048022 CCTGGATCTTAGAATATGCTGGG - Intergenic
949692220 3:6653746-6653768 CCTAAGACTTAACATATGGTTGG - Intergenic
950036743 3:9891226-9891248 CCTACCACGTAATATATGGTAGG + Intronic
954516463 3:51182189-51182211 CATACAACCTATAATATGGTGGG - Intronic
955416970 3:58701463-58701485 CCCAAAACTTTGAATATTGTAGG - Intergenic
955904624 3:63793822-63793844 CCCACTTCTTAGAATATGCTTGG + Intergenic
957697410 3:83658257-83658279 CCTTCAGCTAAGAATGTGGTAGG + Intergenic
958150213 3:89683526-89683548 CCTGCAAATTATAATATGGAGGG - Intergenic
961266367 3:125646180-125646202 CCTACTACCTAGAATGTGTTTGG - Intergenic
962228963 3:133643109-133643131 CATTCAAATTAGAATTTGGTTGG - Intronic
966574066 3:181479447-181479469 CCTACAACCTAGAAGAGAGTGGG + Intergenic
970917640 4:21353961-21353983 CCTACAACCCAGAAGATAGTGGG + Intronic
974435743 4:61855800-61855822 CCTATAGCCTAGAAAATGGTAGG - Intronic
977862685 4:101984313-101984335 CCTCCCTTTTAGAATATGGTGGG + Intronic
978152738 4:105456442-105456464 CATAAAACTTAGAATTCGGTAGG - Intronic
978556180 4:109982976-109982998 CCTACATCTTATAATATGAAAGG - Intronic
980533741 4:134088158-134088180 CCTAAAAATTAGAATATTCTGGG + Intergenic
982387247 4:154822526-154822548 CCTAGAACATAAAATATGGCAGG - Intronic
985804838 5:2035389-2035411 CCAAGAAATTAGAATTTGGTGGG - Intergenic
991511304 5:67379466-67379488 CCTACAGATTGGAATTTGGTGGG - Intergenic
996248137 5:121291554-121291576 CTTCCAACTTAAAATTTGGTAGG + Intergenic
998928051 5:147149024-147149046 CTTACAAATTAAAATATGGAAGG + Intergenic
1000906025 5:166966672-166966694 TCTTCAAATTACAATATGGTAGG - Intergenic
1001942441 5:175750336-175750358 CCTACTCCTTGGAATCTGGTTGG - Intergenic
1004514586 6:16311668-16311690 CCTCCTACTTAGAATACAGTGGG - Intronic
1006231366 6:32589814-32589836 CCTATAACTTGGAATGTGGGTGG - Exonic
1008069122 6:47081555-47081577 GCTACAATTTAGATTCTGGTTGG - Intergenic
1008434887 6:51464482-51464504 CCAAGAACTTAGAGTTTGGTGGG + Intergenic
1009241815 6:61193937-61193959 CCAACAACTTGGAAGAGGGTGGG + Intergenic
1010746334 6:79566204-79566226 CCTAGAATTCAGAATCTGGTAGG - Intergenic
1010897667 6:81384719-81384741 CCTACTACCTGGCATATGGTAGG + Intergenic
1011588034 6:88947255-88947277 CCCACATCTCAGAATATGGGCGG - Intronic
1011588182 6:88947706-88947728 CCCACATCTCAGAATATGGGCGG - Intronic
1011607592 6:89119212-89119234 CCTAGAGCTTAGAATTTGGTAGG + Intergenic
1015847187 6:137532841-137532863 CCTACAACTTAGAGAAAGCTAGG - Intergenic
1018341317 6:162853905-162853927 TCTTGAACTTAGAATATTGTTGG + Intronic
1022161610 7:27716367-27716389 TCTGAATCTTAGAATATGGTTGG - Intergenic
1025118024 7:56275138-56275160 CATAGTACTTAGAATATAGTAGG - Intergenic
1027933751 7:84575426-84575448 AATACAACTTGGAATATAGTAGG - Intergenic
1033922283 7:146409032-146409054 CCTACAACTTAGAATATGGTAGG + Intronic
1036452153 8:8878182-8878204 CCCAGAACTTAGAATATGAAGGG + Intronic
1040528877 8:48249204-48249226 CCTACAATTTAAAACTTGGTGGG - Intergenic
1046091001 8:109502574-109502596 CTTACAACTTAAGAGATGGTTGG - Intronic
1059620426 9:115998679-115998701 CATGCAACTTATAATATAGTTGG + Intergenic
1059709243 9:116852265-116852287 CCTGCACCTTACAATATTGTTGG - Intronic
1187260812 X:17683645-17683667 CTTAGAACTTGGCATATGGTTGG + Intronic
1192748877 X:73966914-73966936 ACCACAACTTAGATTTTGGTTGG + Intergenic
1197704443 X:129623592-129623614 TCTACTATTTAAAATATGGTGGG + Intergenic
1197857932 X:130937683-130937705 CCTACCACATAGTATATGTTTGG - Intergenic
1198225383 X:134640532-134640554 CACACTACTTAAAATATGGTAGG - Intronic
1200573950 Y:4866029-4866051 CCTACCATTTTCAATATGGTTGG - Intergenic
1200970753 Y:9150077-9150099 CCTACAATTTAAAACTTGGTGGG - Intergenic
1202140272 Y:21714236-21714258 CCTACAATTTAAAACTTGGTGGG + Intergenic