ID: 1033923946

View in Genome Browser
Species Human (GRCh38)
Location 7:146433408-146433430
Sequence TGTCGGTTTTATTGTGTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 213}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033923946_1033923952 0 Left 1033923946 7:146433408-146433430 CCTTAAACACAATAAAACCGACA 0: 1
1: 0
2: 1
3: 17
4: 213
Right 1033923952 7:146433431-146433453 GTGGGAGAATTTCCAAAATGGGG No data
1033923946_1033923954 29 Left 1033923946 7:146433408-146433430 CCTTAAACACAATAAAACCGACA 0: 1
1: 0
2: 1
3: 17
4: 213
Right 1033923954 7:146433460-146433482 TTGAAAATACACATTGACAAAGG No data
1033923946_1033923950 -2 Left 1033923946 7:146433408-146433430 CCTTAAACACAATAAAACCGACA 0: 1
1: 0
2: 1
3: 17
4: 213
Right 1033923950 7:146433429-146433451 CAGTGGGAGAATTTCCAAAATGG No data
1033923946_1033923951 -1 Left 1033923946 7:146433408-146433430 CCTTAAACACAATAAAACCGACA 0: 1
1: 0
2: 1
3: 17
4: 213
Right 1033923951 7:146433430-146433452 AGTGGGAGAATTTCCAAAATGGG 0: 1
1: 0
2: 2
3: 26
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033923946 Original CRISPR TGTCGGTTTTATTGTGTTTA AGG (reversed) Intronic
902111335 1:14081101-14081123 TGTTGGTTTTTTTTTTTTTAAGG + Intergenic
910133921 1:83943525-83943547 TGTTTGTTTTGTTCTGTTTAAGG + Intronic
912732554 1:112121811-112121833 TGTCTGTTTTATTCTGTTGGTGG - Intergenic
921491079 1:215776745-215776767 TGACTGTTTTATTGAGTTCATGG - Intronic
921805212 1:219446186-219446208 TGTCTGTCTTATTCTGTTTAAGG - Intergenic
921898436 1:220424855-220424877 TGTCAGCTTTATTATGTTGAGGG + Intergenic
923212334 1:231815034-231815056 TGTAGCTATTATTGTGATTATGG + Intronic
924097433 1:240567344-240567366 TTTCAGTTTTCTTGTGTTTGAGG - Intronic
1063546832 10:6989399-6989421 TATCATTTTTGTTGTGTTTATGG - Intergenic
1064417396 10:15161693-15161715 TGACAGCTTTATTGTTTTTATGG - Intronic
1065108827 10:22419792-22419814 GGTGGGTTTTATTGTTTTTTAGG + Intronic
1065932626 10:30493055-30493077 TTTGGGTTTTATTGTTTTTTGGG - Intergenic
1066241436 10:33539614-33539636 TGCCTGTTTTATTTTCTTTATGG - Intergenic
1066347176 10:34599110-34599132 TGTGGGTTTTGTTTTGTTTGGGG - Intronic
1067272005 10:44799931-44799953 CTTTGGTTTTATTCTGTTTACGG - Intergenic
1068273729 10:54764403-54764425 TGCCAGATTCATTGTGTTTAGGG + Intronic
1068300738 10:55135442-55135464 CTTCGTTTTTATTGTGTTTAGGG - Intronic
1068718322 10:60213182-60213204 TGTGGTTTTTGTTGTGTTTCAGG - Intronic
1069245433 10:66199601-66199623 TGTTTGTTTTTTTGTTTTTAAGG + Intronic
1069645779 10:69995918-69995940 TGTCTGTTTTATTGTATTCCAGG - Intergenic
1070650957 10:78236043-78236065 TTTCTTTCTTATTGTGTTTAAGG - Intergenic
1072059576 10:91797084-91797106 TTTCAATATTATTGTGTTTAAGG + Intergenic
1075290438 10:121225376-121225398 TGTCAGTTTTGTTGTGTATGTGG - Intergenic
1078436107 11:11327303-11327325 TGTTGGTTCTATAGTGTTCAAGG - Intronic
1079833096 11:25295788-25295810 TTTGGTATTTATTGTGTTTAGGG - Intergenic
1080523810 11:33093166-33093188 TCTTGGTTTTATTTTGCTTATGG - Intronic
1081180644 11:39982409-39982431 TATGGCTTTTATTGTGTTGAGGG + Intergenic
1082084050 11:48034462-48034484 TGTTGCTTTGATTGTGTTAAAGG + Intronic
1087309161 11:96520483-96520505 TGTGTACTTTATTGTGTTTATGG + Intergenic
1087660822 11:100986118-100986140 TGGAGATTTTATTGTGTCTAGGG + Intronic
1093365120 12:18285510-18285532 TGTAGGATTTATTGTGTATGTGG + Intronic
1093916408 12:24807087-24807109 TGTTATTATTATTGTGTTTAGGG - Intergenic
1094269707 12:28599688-28599710 TGTTGGTTTGTTTATGTTTAAGG + Intergenic
1094322019 12:29194680-29194702 TTTGGGTTTTAATGTGGTTAAGG + Intronic
1098214251 12:68199196-68199218 TGTCTGTTTTATTCTCTCTAGGG - Intergenic
1099446867 12:82763137-82763159 TGTCTGCTTTACAGTGTTTAGGG - Intronic
1099981693 12:89611738-89611760 TGTTGGTATTCTTTTGTTTAGGG + Intronic
1102397081 12:112595623-112595645 TTTGGTTTTTATTGTGGTTAGGG - Intronic
1103149319 12:118623217-118623239 TGTAGGTTTTATTATATTCAGGG - Intergenic
1103892537 12:124250602-124250624 AGTCGGTTTTATGTTGTTCAGGG - Intronic
1106400467 13:29425008-29425030 TGTCACTTTTATTGTTTTAATGG + Intronic
1106844598 13:33724727-33724749 TGTCGATTTTCTGGTCTTTATGG - Intergenic
1107632609 13:42357125-42357147 TGTCCAATTTATTGTTTTTAAGG - Intergenic
1109847117 13:68008320-68008342 TGTCATTTTTAATATGTTTATGG + Intergenic
1111502031 13:89134035-89134057 TGTCAGTTTCATTGTGTTACTGG - Intergenic
1112943253 13:104892592-104892614 TGTTTGTTTTAATGTTTTTATGG + Intergenic
1113247304 13:108411840-108411862 TGTGGTTTTATTTGTGTTTATGG + Intergenic
1114720880 14:24880668-24880690 TGTCTGTTTTATTGTATTAATGG - Intronic
1115551174 14:34506478-34506500 TGTCTGTTTTATTGTGTAAGAGG - Intergenic
1115977297 14:39011265-39011287 TCTGGGTTTTAATGTGTTTAGGG - Intergenic
1116027081 14:39527630-39527652 TGTTGGTTTGATTTTGTGTATGG + Intergenic
1116209628 14:41918605-41918627 TGTCTGTTCTATTGTGTCTGGGG - Intergenic
1118686445 14:68296076-68296098 GGTCCTTTTTGTTGTGTTTAGGG + Intronic
1119060266 14:71466715-71466737 AGTAGTATTTATTGTGTTTAGGG + Intronic
1120965044 14:90159414-90159436 TGCCTGATTGATTGTGTTTATGG - Intronic
1122698435 14:103570162-103570184 TGTAGGTTTTATTTTTTTAATGG + Intronic
1123828233 15:24105272-24105294 TATAGGTTTTATGGTTTTTATGG + Intergenic
1124381327 15:29169772-29169794 TGTAGGGTTTCTTGAGTTTAGGG - Intronic
1125071559 15:35560634-35560656 TATGGGTTTTATATTGTTTATGG - Intergenic
1126028320 15:44470945-44470967 GGTGTATTTTATTGTGTTTAAGG - Intronic
1126284284 15:46993743-46993765 TGTGGGTTTTTTTGTGTTTTTGG + Intergenic
1127020566 15:54743011-54743033 TGTCTATTTTAATTTGTTTAAGG - Intergenic
1127802288 15:62487664-62487686 TGTCGTTTTTATTTTTTATAGGG - Intronic
1129488448 15:75901127-75901149 TGTAGGCTTTATTGAGTTTCTGG + Intergenic
1130825232 15:87537438-87537460 TGTCTGTCATATTGTGTTGATGG - Intergenic
1130897874 15:88184702-88184724 TGTCATTTGTATTGTCTTTATGG - Intronic
1134665846 16:16018018-16018040 TTTGGGTTTTATTGTGAGTATGG + Intronic
1136637520 16:31534453-31534475 TGTTTGTTTTGTTTTGTTTATGG - Intergenic
1137734622 16:50714534-50714556 TGGCAGTTTTAGTGTGTGTAAGG - Intronic
1140016174 16:71188073-71188095 TTTGGCTTTTATTGTGGTTAAGG - Intronic
1141937143 16:87248302-87248324 TGTCGGTTTTTTTGTTTTTTGGG + Intronic
1143242756 17:5457901-5457923 TGTCGTTTTCATAGTGTTTGGGG - Intronic
1143921984 17:10337262-10337284 TGTAGGTTTTATTATTGTTAAGG - Intronic
1146785173 17:35713576-35713598 TGTTGGTGCTATTGTGATTAGGG - Intronic
1148033150 17:44636628-44636650 TGTGTGTTTTATTGTATTTAGGG - Intergenic
1149287052 17:55176628-55176650 TGTCAGTTTTACTGTGTTGAGGG + Intergenic
1152495790 17:80670556-80670578 TTTCGTATTTATTGTGTTTAGGG + Intronic
1156776770 18:40799283-40799305 TGCCAGTTTTCTTGTTTTTATGG - Intergenic
1159069736 18:63610564-63610586 TTTGGCTTTTATTGTGGTTAGGG + Intergenic
1159661368 18:71099523-71099545 TGTCTGTTTTATTGTGTAAAGGG + Intergenic
1159740618 18:72165079-72165101 TGCCTGTTTTATTGTGTAAAGGG + Intergenic
1160546827 18:79663348-79663370 TTTTGGTTTTATTTTGTTTTTGG - Intergenic
1161013700 19:1972421-1972443 TGTCGTTTTTTCTGTTTTTAAGG + Intronic
1163265192 19:16216634-16216656 TGGGGGTTTGATTGTGTATAAGG + Intronic
1164844173 19:31417845-31417867 TGTCTGTGATATTGTGTTAAGGG - Intergenic
1167929390 19:52851807-52851829 TGTAGGTTTTATTATTTTTTGGG - Intronic
1167988915 19:53341163-53341185 TGTATGTTTCATTGTGTTAACGG + Intronic
1168680461 19:58311760-58311782 TGTCAGTTTTAAATTGTTTAGGG - Intronic
925779042 2:7363239-7363261 TTTCTGTTTTATTGTGGATATGG - Intergenic
927836045 2:26400151-26400173 TGGGGCTTTTATTGTGGTTAAGG + Intergenic
929151695 2:38754801-38754823 TGTTTGTTTTTTTGTTTTTAAGG + Intronic
931381243 2:61755492-61755514 TGTGGGTTTTTTTGTATTTTTGG + Intergenic
932582939 2:73004354-73004376 TTTTGTTTTTATTGTGGTTAAGG - Intronic
936173591 2:110198585-110198607 TGTTTGTTTTTTTGTTTTTAGGG - Intronic
938340307 2:130531675-130531697 TGTGGGTTTTATTGTTATTTAGG - Intergenic
938349523 2:130589063-130589085 TGTGGGTTTTATTGTTATTTAGG + Intergenic
939348809 2:141004732-141004754 TGTTGGTGTTATTGTGCTGAAGG + Intronic
940300364 2:152170510-152170532 TCTATGTTTTCTTGTGTTTATGG - Intronic
940668948 2:156644114-156644136 TATGGCTTTTATTGTGTTGAGGG - Intergenic
941460965 2:165771382-165771404 TGTTGATTTTCTTGTTTTTAGGG - Intronic
942913874 2:181278677-181278699 TGTCTTATTTATTTTGTTTATGG - Intergenic
942975347 2:182010681-182010703 GGTCGGCCTTATTGTGTTTTAGG + Intronic
943890458 2:193279343-193279365 TGTCTGTTTTATTGACTTAATGG - Intergenic
944603136 2:201323445-201323467 TGACAGTTTTTTTCTGTTTAAGG - Intronic
944817133 2:203388992-203389014 TTTGGGTTTTATGTTGTTTAAGG + Intronic
946720016 2:222595044-222595066 TGTCTGCTTTTTTGTGTTTGAGG - Intronic
946794673 2:223337565-223337587 TTTAGGATTTAATGTGTTTATGG - Intergenic
948894613 2:240922361-240922383 TGTCGGGTTCATTGTGTGGAAGG + Intronic
1169991520 20:11508995-11509017 TGTGGCTTTTATTATGTTAAGGG - Intergenic
1170379968 20:15747570-15747592 TGTCAGTAATATTTTGTTTAGGG + Intronic
1170688959 20:18594806-18594828 TGTGGGTTTGAATGTCTTTATGG + Intronic
1171080091 20:22172298-22172320 TGTAGCTTTTATTTTGTTTTTGG + Intergenic
1172398989 20:34632870-34632892 TATAGGTTTTATTGTTTTTCTGG - Intronic
1173837254 20:46134157-46134179 TGTGGGTTTTTTTGTTTTTTTGG - Intergenic
1175610685 20:60348700-60348722 GGTCTGTTTTATTTTGTTTCTGG + Intergenic
1177098038 21:16863284-16863306 TCTGTGTTTTATTGTGTTAAAGG + Intergenic
1178331578 21:31699794-31699816 TGTCTGTTTTATTTGGTTTATGG - Intronic
1178890799 21:36519738-36519760 TGTGGGTTTTTTTGTTTTTGGGG - Intronic
1179061616 21:37984540-37984562 TGGCGGTTTTATTTTTTTTGAGG + Intronic
1180555902 22:16573812-16573834 TGTAGGTTTCACTGTGTGTATGG + Intergenic
950438980 3:12996584-12996606 TGTCTTTTTTACTTTGTTTATGG - Intronic
950753995 3:15157012-15157034 TGTTGGTTTTATTGTGTAACAGG + Intergenic
954526504 3:51276460-51276482 TGACGGTTTGGTTGTGTTTGTGG + Intronic
955722310 3:61895679-61895701 TTTAAGTTTTATTGTGATTAGGG + Intronic
956555939 3:70522481-70522503 TCTAGGTTTTATTGTGTGTTAGG + Intergenic
959597968 3:108148225-108148247 TGTCAGTTTGATTGGATTTAGGG - Intergenic
961062212 3:123839090-123839112 TGTTTGTTTTGTTTTGTTTAAGG - Intronic
961564938 3:127756635-127756657 TGTAGGTTGTATTGTGATTCAGG - Intronic
963340695 3:144029048-144029070 TGTCATTTTTCCTGTGTTTACGG + Intronic
966035148 3:175403052-175403074 TGTTTGTTTTATTTTGTTTGGGG + Intronic
966368581 3:179220337-179220359 TGTAGGTTTCACTGTGTGTATGG + Intronic
967059620 3:185860607-185860629 TGTCTGTTTTACTCTGTTGATGG - Intergenic
970009031 4:11438372-11438394 TGTCTGTGATACTGTGTTTATGG + Intergenic
971782281 4:31052117-31052139 TGTCTGTTTTATTTTGTTTAAGG + Intronic
972747033 4:41944771-41944793 TGTTGGTTTTCTTTTGTTTTAGG + Exonic
973076321 4:45931893-45931915 TGTCACTTCTTTTGTGTTTAGGG - Intergenic
973949332 4:55995320-55995342 TGTCTGTTTTGTTTTGTTTTAGG + Intronic
974763962 4:66316220-66316242 TGCGGGTTTTAATATGTTTAGGG + Intergenic
974997584 4:69180292-69180314 AGTCTGTTCTATTGTCTTTAAGG + Intronic
975002449 4:69241251-69241273 AGTCTGTTCTATTGTCTTTAAGG + Intergenic
975010555 4:69345242-69345264 AGTCTGTTCTATTGTCTTTAAGG + Intronic
978392268 4:108239641-108239663 TTTCTGTTTTAGTGAGTTTAGGG - Intergenic
979121629 4:116909949-116909971 TGAGGCTTTTATTGTGGTTAGGG + Intergenic
980150403 4:129040212-129040234 TGTTGGTTTAATTGTGTTTCAGG - Intronic
982637961 4:157920818-157920840 TGAAGGTTTTATTGTTTTGAAGG + Intergenic
983572610 4:169225985-169226007 TGTCTCTTCTGTTGTGTTTAAGG - Intronic
984020357 4:174477435-174477457 TGACAGTTTTTTTCTGTTTAAGG - Intergenic
984025908 4:174543028-174543050 TGTAGTTTTTGTTGTGTTTTGGG - Intergenic
987701014 5:21398380-21398402 TGTCGGTTTTCTTGCTTTTGAGG + Intergenic
989294662 5:39810029-39810051 TCTCTGTTTTAATGTGTATATGG + Intergenic
990736855 5:58873866-58873888 TGGTCGTTTTATTTTGTTTAGGG - Intergenic
991218054 5:64178866-64178888 TTTCAGTCTTATTGTGTATATGG + Intronic
991319913 5:65361149-65361171 AGTCTGTATTTTTGTGTTTAAGG - Intronic
992345094 5:75868600-75868622 TGAAGGTTTTATTTTGTTTTTGG - Intergenic
992862920 5:80930050-80930072 TGTCTGTTTGTTTTTGTTTAGGG - Intergenic
993527645 5:88986041-88986063 TGTGGCTTTTTTTGTGTCTATGG + Intergenic
995891337 5:116955683-116955705 TGTGGGTTTTGTTTTGTTTTTGG + Intergenic
997391197 5:133518194-133518216 TGTCGTTTGTCTTTTGTTTATGG - Intronic
997632047 5:135376135-135376157 TGTAGGTTTTATTTTCTCTATGG - Intronic
997645435 5:135478414-135478436 TGTGGGTTTTTTTGTTTTTTGGG + Intergenic
999055476 5:148570847-148570869 TTTTTGTTTTATTTTGTTTAGGG + Intronic
999508115 5:152219310-152219332 TGTTGGTTTTGTTTTGTTTTTGG + Intergenic
1004083515 6:12420785-12420807 GGTGGGTTTTTTTGTGTGTAAGG - Intergenic
1004891404 6:20104294-20104316 TGTTAGTTGCATTGTGTTTAAGG - Intronic
1005350145 6:24926356-24926378 TGGCAGTTTTATTGTGTAGAGGG - Intronic
1005665711 6:28051940-28051962 TGTTTGTTTTAATGTATTTAAGG - Intergenic
1005665945 6:28055018-28055040 TGTTTGTTTTAATGTATTTAAGG - Intergenic
1009638420 6:66298003-66298025 TGTCTGGATTATTTTGTTTAAGG + Intergenic
1010941434 6:81922492-81922514 TTTTGGCTTTATTCTGTTTATGG - Intergenic
1011990108 6:93504458-93504480 TGTCTTTTTTATTGTTATTATGG - Intergenic
1012555043 6:100501222-100501244 TGTCTGTATTATTCTGTTTCTGG + Intergenic
1012788632 6:103663256-103663278 TATCTGCTTTTTTGTGTTTATGG + Intergenic
1013479342 6:110540077-110540099 TGTCTGTTTTACTCTGTTGATGG + Intergenic
1014575256 6:123061293-123061315 TTTCGGTTTTGTTTTGTTTGAGG - Intronic
1015767545 6:136734686-136734708 TTACAGTTTTATTGTGGTTAAGG + Intronic
1015944348 6:138484741-138484763 TGTCTGTTTTGTTTTGTTTTGGG - Intronic
1017619760 6:156284281-156284303 TGACAGTTTAAGTGTGTTTAGGG - Intergenic
1018536200 6:164822723-164822745 TGTGGGTTTAATTGTTTTAATGG - Intergenic
1018582292 6:165317572-165317594 TGTCGGTGTCATTGTATTTAGGG - Intergenic
1021276499 7:18658038-18658060 TCACGGTTTGATTGTGTTTTGGG + Intronic
1021728730 7:23575472-23575494 TGTAGGCTTTATTGTGCTTGGGG - Intergenic
1022146955 7:27553987-27554009 TGTATGTTTGTTTGTGTTTATGG + Intronic
1023539224 7:41247576-41247598 TGTATGTTTTGTTTTGTTTAAGG + Intergenic
1024712681 7:52034984-52035006 TGTTGATTTGATTGGGTTTAGGG + Intergenic
1027023464 7:74833449-74833471 TTTGGGTTTTATGATGTTTATGG - Intronic
1027064467 7:75111871-75111893 TTTGGGTTTTATGATGTTTATGG + Intronic
1029882892 7:103835525-103835547 GGGAGGTTTTATTGTGTGTAGGG + Intronic
1030039175 7:105434483-105434505 TGTGGGTTTTTTTGTGTGTGTGG - Intergenic
1030471738 7:109972675-109972697 TGTTGCTTTTATTGTATTTATGG - Intergenic
1030696889 7:112595318-112595340 TTTTGGTTTTATTTTGTTTATGG - Intergenic
1030764666 7:113394481-113394503 TGTCTGTTATATTGTCTTGAGGG - Intergenic
1032306391 7:130735743-130735765 TGTCAGTGTTATTATTTTTAAGG + Intergenic
1033923946 7:146433408-146433430 TGTCGGTTTTATTGTGTTTAAGG - Intronic
1035938710 8:3872225-3872247 TGTCGTTGTTGTTGTTTTTAGGG + Intronic
1036096995 8:5735349-5735371 TGTTTATTTTATTTTGTTTATGG + Intergenic
1036989143 8:13572053-13572075 TGTCTATTTTATTGAGTTTCAGG + Intergenic
1037849456 8:22314792-22314814 TGTTGGTTTTATTTTGTTTTGGG + Intronic
1039117221 8:34104727-34104749 TGTCTGTTTTTTGGTGTTTCAGG + Intergenic
1039542006 8:38380969-38380991 TGTGGGTTTTACTGTTTTGAGGG - Intronic
1040075632 8:43226080-43226102 TGTGGATTTTATTCTTTTTATGG + Intergenic
1040646355 8:49401716-49401738 GGTTGGTTTTGTTGTGATTAAGG + Intergenic
1043329200 8:79093131-79093153 TGTAGGTTTTATTATTATTAAGG + Intergenic
1043803933 8:84647062-84647084 TGTTGGTTTTATAGTTTTTTGGG + Intronic
1043909707 8:85848289-85848311 TGTCGCTTTTATTAGGTTTTTGG - Intergenic
1044695029 8:94914193-94914215 TGTCGGTTTTATAGTTTTAGTGG + Intronic
1050933422 9:11361097-11361119 TGTCGATTTTATTGGATTGAAGG + Intergenic
1051528313 9:18072138-18072160 TGTCGTTTTTCTTGTTTTTCAGG + Intergenic
1052872237 9:33518632-33518654 TGTGGATTTTGTTGTTTTTATGG + Intergenic
1053411642 9:37919706-37919728 TGTCGTTTGTGTTGTGTGTATGG - Exonic
1057685375 9:97229328-97229350 TGTGGATTTTATTGTTTTTATGG - Intergenic
1058328927 9:103734360-103734382 TGTGGGATTTGTTGTGATTAGGG + Intergenic
1059620000 9:115993399-115993421 TATTTATTTTATTGTGTTTAAGG + Intergenic
1060574698 9:124680329-124680351 TGTGGGTTTTATTCTGGTTGTGG - Intronic
1185948607 X:4405051-4405073 TGTTGGTTTGTTTGTGTTCAGGG + Intergenic
1187275040 X:17809765-17809787 TCTGGGTTTTTTTGTGTTTTTGG + Intronic
1187440721 X:19316764-19316786 TAACGGTTTTAGTGTCTTTAGGG + Intergenic
1189316388 X:40059757-40059779 TGTCGGGTTTATGGCCTTTATGG - Intronic
1189993402 X:46615451-46615473 TGTCAGTTTTCTTGTGTCTTTGG + Intronic
1190512457 X:51186771-51186793 TTTCTGTTTTATTCTTTTTATGG - Intergenic
1190520689 X:51276767-51276789 TGGTGGTTTTATAGGGTTTAAGG + Intergenic
1191637613 X:63394339-63394361 TGTTGGTTTTGTTTTGTTTTGGG + Intergenic
1193463640 X:81819531-81819553 TAATGTTTTTATTGTGTTTAGGG - Intergenic
1193790096 X:85807436-85807458 TGTCGGTTTTATCATCTTTGTGG + Intergenic
1193792792 X:85836534-85836556 TGTAGGTTTTATTAAGTTAAGGG - Intergenic
1193899721 X:87162364-87162386 TGTCATTTTTATTGGGTATAAGG + Intergenic
1194477674 X:94378859-94378881 TTTGGGTTTTATTGTGGTTGTGG - Intergenic
1196387614 X:115175389-115175411 TGAGGGTTTTAATTTGTTTATGG - Intronic
1196648212 X:118140808-118140830 TATCTGTTTGCTTGTGTTTATGG - Intergenic
1197196344 X:123705317-123705339 TATAGGTTTTAGTTTGTTTATGG - Intronic
1199358590 X:146890134-146890156 TATGGCTTTTATTATGTTTAGGG - Intergenic
1200307890 X:155047110-155047132 TGTCAGTTTTCTTTTGTTTTTGG - Intronic
1201483016 Y:14460860-14460882 TGTTGGTTTGTTTGTGTTTCTGG - Intergenic