ID: 1033923949

View in Genome Browser
Species Human (GRCh38)
Location 7:146433425-146433447
Sequence TTTGGAAATTCTCCCACTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033923949_1033923954 12 Left 1033923949 7:146433425-146433447 CCGACAGTGGGAGAATTTCCAAA 0: 1
1: 0
2: 1
3: 22
4: 202
Right 1033923954 7:146433460-146433482 TTGAAAATACACATTGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033923949 Original CRISPR TTTGGAAATTCTCCCACTGT CGG (reversed) Intronic
901386639 1:8913860-8913882 TTAGGAAGTTCTCCCTCTATGGG - Intergenic
905570870 1:39004273-39004295 TTTGGAAAATCTATCACAGTAGG - Exonic
908391833 1:63690306-63690328 ATTGGAAAATCTTCCAATGTGGG + Intergenic
908874661 1:68658604-68658626 TTTGGGACTTCTCCCATTTTGGG - Intergenic
909401494 1:75236778-75236800 TTTGGAAATATGCCCACTGTTGG - Intronic
909720594 1:78764880-78764902 TTTGGATATACACCCACAGTGGG + Intergenic
910556882 1:88544197-88544219 TTTTGATATTTTCCAACTGTTGG - Intergenic
911019735 1:93374726-93374748 TGTGTAAATGCTCCCTCTGTGGG - Intergenic
912044849 1:105441460-105441482 TTTTGTAATTCACTCACTGTGGG - Intergenic
913111598 1:115662098-115662120 ATAGGAATTTCTCTCACTGTAGG + Intronic
913503510 1:119494276-119494298 TTTGTATATTCTCCTACTGAAGG - Intergenic
916384912 1:164256121-164256143 TTTGGAAAATTTCCCCCTTTTGG + Intergenic
916918677 1:169439081-169439103 TTTGGATATAGCCCCACTGTGGG - Intronic
919591593 1:199510728-199510750 TTTCAAAATTCTCCCAATGCTGG + Intergenic
920751125 1:208678371-208678393 TTTGGAAATGCTCCCAAAATAGG + Intergenic
921765729 1:218971177-218971199 TTTGGAAATTCTTCAAGAGTGGG - Intergenic
1063102969 10:2966745-2966767 TTTAGAAATACTCTCACAGTGGG - Intergenic
1063267949 10:4475107-4475129 TTGGGCAGGTCTCCCACTGTGGG - Intergenic
1063658557 10:8016172-8016194 TTTTGAAATAATCCCAGTGTAGG + Exonic
1063926876 10:10987317-10987339 TTGGGAAATTCTCCAATTTTAGG - Intergenic
1065202428 10:23326470-23326492 TTTAGCTATTCTCCTACTGTAGG - Intronic
1065759004 10:28964362-28964384 CTTGGAGATTTTCCCACTGTCGG + Intergenic
1066339340 10:34514621-34514643 TTTGCATATTCTCCCACTGGTGG + Intronic
1069010352 10:63364962-63364984 TTTGGAAATATTCCTCCTGTAGG - Intronic
1071133255 10:82420772-82420794 TTTGTCCATTCTCCCACTGAAGG - Intronic
1071558894 10:86630358-86630380 TTTGGGGGTTCTCCCTCTGTTGG + Intergenic
1073586021 10:104710887-104710909 TTTGCAATTTCTGCCTCTGTTGG + Intronic
1073873349 10:107891552-107891574 TTTGGAAATTAACCCATTATTGG + Intergenic
1076656995 10:132031280-132031302 TTTGGAACTGCTCCCATTGTTGG - Intergenic
1078915350 11:15773644-15773666 TTAGGAAATGCTCCCAGTGTGGG - Intergenic
1081490664 11:43565951-43565973 TTTGAAACTTCTCTCAATGTTGG + Intronic
1081557901 11:44184018-44184040 TGTGGAAATTCTCCCATCCTGGG + Intronic
1082584040 11:54912063-54912085 TTTGGAAATACTGCTATTGTAGG - Intergenic
1083022716 11:59523491-59523513 TTTTGCAATTCTCCCAATGTAGG - Intergenic
1086477932 11:87199510-87199532 TTTTTAAATACTACCACTGTAGG - Intronic
1087180041 11:95133009-95133031 CTTGTAATTTCTCTCACTGTGGG - Intergenic
1087660505 11:100982186-100982208 TTTGCAGCTTCTACCACTGTTGG - Intronic
1090445725 11:126763238-126763260 TCTGGAACATCTCCCAATGTCGG + Intronic
1093294896 12:17377153-17377175 TTTAAAAATTCTCCCTCTGGAGG - Intergenic
1093404992 12:18793365-18793387 CTTGGACTATCTCCCACTGTGGG + Intergenic
1093567985 12:20631586-20631608 TAGGGAGAGTCTCCCACTGTGGG + Intronic
1094104322 12:26793801-26793823 TTTGGAAATATTCCCTATGTAGG + Intronic
1100117333 12:91323163-91323185 TTTTGAAATAGTTCCACTGTGGG - Intergenic
1100385432 12:94101440-94101462 CTTTGTAATTCTCCCAGTGTAGG + Intergenic
1101850750 12:108400109-108400131 TTTAGGAATGCTCCAACTGTGGG - Intergenic
1102787854 12:115619056-115619078 AGTGGAAATTTTCCAACTGTTGG + Intergenic
1103030377 12:117607547-117607569 CTTGGAGATTCTCCCACTGCTGG - Intronic
1103919677 12:124392941-124392963 CTTGCACATCCTCCCACTGTTGG + Intronic
1105698846 13:22918734-22918756 TTTGGTAATTTTTCCATTGTGGG - Intergenic
1106327037 13:28702336-28702358 CTTAAACATTCTCCCACTGTTGG + Intronic
1107064970 13:36203457-36203479 TTGAGACATTCTCCCAGTGTTGG + Intronic
1108123450 13:47214768-47214790 TTTGGTAACTGTCCCATTGTGGG + Intergenic
1108415837 13:50197382-50197404 TCTGAATATTCTGCCACTGTTGG - Intronic
1109776285 13:67045027-67045049 TTTGGAAATTCACAAATTGTTGG + Intronic
1110237358 13:73230615-73230637 TTTGGCAATTCTCCCACCAAAGG + Intergenic
1110349669 13:74492585-74492607 TTTGGAACTTCTCACATTGCTGG - Intergenic
1111092256 13:83462475-83462497 TTTGGAAGTTCTCACCCAGTTGG - Intergenic
1114353076 14:21875877-21875899 TATGGAATGTCTGCCACTGTGGG - Intergenic
1114462119 14:22893043-22893065 TCTGGAAATTTTTCCACTCTGGG + Intergenic
1114849432 14:26365808-26365830 TTTGCCAATTCTTCCACTTTAGG - Intergenic
1115805032 14:37041108-37041130 TTTGGAAATGCTGCCTTTGTGGG + Intronic
1115809746 14:37093591-37093613 TTTGGCAATTAGCCCATTGTGGG + Intronic
1116308635 14:43292247-43292269 TTTTGAAATTATCCAAATGTTGG + Intergenic
1118683464 14:68267191-68267213 TTTGGAAATTCTTGCTCTTTTGG + Intronic
1118836621 14:69482960-69482982 CTTGGAAATCTTCCCACTTTAGG - Intergenic
1119517325 14:75258627-75258649 TTAGAAAACTTTCCCACTGTTGG - Intronic
1120662424 14:87266219-87266241 TTTGTAATTTCTCCAACTCTTGG + Intergenic
1124899373 15:33808024-33808046 CTGGGAAATTCTCCCAGGGTAGG - Intronic
1125250576 15:37697861-37697883 TTTGGTGATTCTCCAACAGTTGG - Intergenic
1126367943 15:47915312-47915334 TTTGAGAATGCTCCCACTTTTGG - Intergenic
1127367916 15:58309036-58309058 TTTGGGAATCCTCCCACTTCTGG + Intronic
1127706065 15:61548348-61548370 TTTGGAAGCTCTGCCACAGTGGG - Intergenic
1128840578 15:70847770-70847792 TTTGGATATTCTCCTCCTATAGG - Intronic
1130355286 15:83124084-83124106 TTTAGCCATTCTCCCACTGTTGG - Intronic
1130729056 15:86471675-86471697 TTTGTAAATTTTCCCTCTTTAGG + Intronic
1131782335 15:95873123-95873145 TTGGGAAATTCTTCCTCTGGAGG - Intergenic
1132845300 16:1998522-1998544 TCTGGAAATTCTCCCCCAGCAGG + Exonic
1135399796 16:22158600-22158622 TTTGCACATTCTGCCACTGATGG - Intergenic
1137570297 16:49561228-49561250 GGTGTAAATACTCCCACTGTGGG - Intronic
1138232481 16:55348899-55348921 TTAGGAAATTCTCCAGTTGTTGG - Intergenic
1141469729 16:84230102-84230124 TTTGAAAAATCTCTCTCTGTGGG + Intronic
1144342340 17:14320233-14320255 GATTGAAATTCTCCCTCTGTAGG - Intronic
1145942377 17:28749397-28749419 TCTGGAAATTCTTCCAGTTTGGG - Exonic
1146366369 17:32231941-32231963 TTTGGTACTCCTTCCACTGTAGG + Intronic
1146762574 17:35491199-35491221 TTTGGAAAAGCTCCCACTGGTGG + Intronic
1150722329 17:67624067-67624089 TTTGGCAATTCTCCCATAGTAGG + Intronic
1153313941 18:3703825-3703847 TGTGGAAAGTCTCCCTCTGGCGG - Intronic
1154112381 18:11581165-11581187 CTGGGACATTCTCCTACTGTGGG - Intergenic
1154977461 18:21473770-21473792 TTTGTAAATTTTCCCAGTCTCGG - Intronic
1154992927 18:21613086-21613108 TTAGGAAAATCTCCCAATATAGG + Intronic
1166280161 19:41787098-41787120 TGTGAAAAATCTCCCACTCTTGG + Intergenic
925332080 2:3066367-3066389 GTTGAACATTCTCCCAGTGTAGG + Intergenic
925364408 2:3302059-3302081 TCTGGAGATTTTCCCACTGCTGG - Intronic
925774069 2:7316023-7316045 TTTATAAATTCTCCTACTGAAGG - Intergenic
926988687 2:18652744-18652766 ATTAGAAATTCTCCCACTCTTGG - Intergenic
927631504 2:24778036-24778058 TTTCGAAATTCTCACACTCTAGG + Intergenic
928766136 2:34648073-34648095 TGTGGCAATTCTCTTACTGTTGG + Intergenic
929951025 2:46409604-46409626 GCTGGAATTTCTCCCTCTGTTGG - Intergenic
930288936 2:49468695-49468717 TGTCTAAATACTCCCACTGTGGG + Intergenic
930466665 2:51760522-51760544 TTTGGAAGTTATCCCAAAGTGGG - Intergenic
930710125 2:54543035-54543057 TTTGGAGGTCCTCCCACTGCTGG + Intronic
931256007 2:60573525-60573547 GTTGAAAATTCTCCCGCTTTGGG - Intergenic
932058327 2:68468737-68468759 TTTGCAGATTCTAGCACTGTGGG + Intronic
933715430 2:85356250-85356272 TTTTGAATTTCTACCATTGTTGG + Intronic
934039431 2:88115739-88115761 TTTTAAAATTCTCCCTTTGTAGG + Intergenic
934591839 2:95560458-95560480 GTGGGAAATTCTCACACTGCAGG - Intergenic
934938958 2:98486025-98486047 TCTGGCAAATCTCCCACTGAAGG - Intronic
939447359 2:142327767-142327789 CTTGGAGATTCTCCCATAGTGGG + Intergenic
939999800 2:148955754-148955776 AACGGAGATTCTCCCACTGTGGG - Intronic
942208388 2:173646463-173646485 TTTGGAAAATCTGCCACTTGGGG - Intergenic
944098260 2:195994267-195994289 TTTGGAAAAGCTTCCACTGGTGG - Intronic
946765310 2:223035352-223035374 TTTGGCAATGGTCCCAGTGTGGG + Intergenic
946775962 2:223141387-223141409 TTTGTAAATTTTTCCACGGTAGG + Intronic
948077400 2:235175808-235175830 TTTGGCAATTCCTCTACTGTTGG + Intergenic
1170954929 20:20971171-20971193 TTTGAAAATTATCAGACTGTAGG + Intergenic
1172867460 20:38111184-38111206 TTTGGAAAATTCTCCACTGTGGG - Intronic
1173451913 20:43172241-43172263 TTTGGAAATTATCCCACTAGTGG - Intronic
1174592223 20:51655102-51655124 ATTGGAACTTCTCATACTGTAGG - Intronic
1177575292 21:22946971-22946993 TTTGGAAATTCAGACTCTGTTGG - Intergenic
1180043187 21:45291046-45291068 TTTGGAAAGACTCCAGCTGTGGG - Intergenic
1180917054 22:19496715-19496737 CTTGGAAATTCTCTCCCTGGAGG + Intronic
1181119532 22:20656731-20656753 TCTGGCCATACTCCCACTGTGGG + Intergenic
949809999 3:7996853-7996875 TTTGGAAATCCTCCTACTTAAGG + Intergenic
951625060 3:24651319-24651341 TTTGGAAATCCTACCACATTTGG + Intergenic
956092719 3:65685069-65685091 TTCGGAAATTATACCACTGGAGG + Intronic
957133416 3:76252279-76252301 TTTGGAAATGAACCCACTCTTGG - Intronic
958715026 3:97770035-97770057 TTTGGATATATTCCCACAGTGGG + Intronic
960127138 3:114012403-114012425 TTTAGAAATTCACTCACTGATGG + Intronic
960224488 3:115153828-115153850 TTTGAAAATTCCCCAAATGTAGG - Intergenic
961016994 3:123476039-123476061 TTTGGAGCTTCTCCCACCTTTGG + Intergenic
965374373 3:167904264-167904286 TTTGGAACTTCTGACATTGTAGG - Intergenic
965677619 3:171214431-171214453 AGTGGCAATTCTGCCACTGTGGG - Intronic
967952498 3:194852018-194852040 TTAGGAAATTCTCCCAACATAGG - Intergenic
968978753 4:3835496-3835518 TTTTGACAGTCTCCCACTCTAGG - Intergenic
970662119 4:18296966-18296988 TTTGCAAATGCTGCCTCTGTAGG + Intergenic
970944610 4:21676203-21676225 TTTAGAAGTTCTCTGACTGTGGG - Intronic
971927636 4:33034119-33034141 TTTGAAAATCCTTACACTGTGGG + Intergenic
972610762 4:40653452-40653474 TTTGGAAAATCTCCCAATTTGGG + Intergenic
972658240 4:41087775-41087797 TATGTAAAATGTCCCACTGTAGG - Intronic
974961770 4:68711078-68711100 TTTGGAAATTCTTCCAATGTAGG + Intergenic
975204892 4:71634216-71634238 TTTGAAAATACTTCCACTTTGGG - Intergenic
977578845 4:98703106-98703128 TTTATAAATTTTCCTACTGTAGG - Intergenic
977920028 4:102632925-102632947 TTTGCAAACCCTCCCACTCTGGG - Intronic
982364927 4:154567152-154567174 TTTGAAAAATTTCCAACTGTGGG - Intronic
983235740 4:165177521-165177543 TTTGGAAATTATAATACTGTAGG - Intronic
984066049 4:175049097-175049119 TTTGGCAATTCTCCCTCTCGGGG + Intergenic
987723516 5:21667541-21667563 TTTTGAAATTGTCCCATTCTTGG + Intergenic
991008010 5:61850372-61850394 TGTTGAAATTATCCCAGTGTTGG + Intergenic
992364272 5:76075829-76075851 TTTGGAACTGCTGCCACTTTAGG - Intergenic
992618599 5:78570427-78570449 TTTGGAAACACACCCACTGGAGG - Intronic
994023596 5:95056269-95056291 TTTCACAATTCTCCCATTGTAGG + Intronic
994257444 5:97616102-97616124 TCTGGGAATTAGCCCACTGTTGG - Intergenic
995096281 5:108239562-108239584 TTTGGCAAGCCTCCTACTGTGGG + Intronic
995356880 5:111248361-111248383 TTTGGAGATTTTCTTACTGTGGG + Intronic
995881018 5:116844914-116844936 TTTCCAAATTCTCTCTCTGTTGG + Intergenic
996985093 5:129551913-129551935 TGTGAAAATTCTCACACTTTTGG + Intronic
997040943 5:130253198-130253220 TTTGGAAAATGTCCCTCAGTTGG - Intergenic
997370894 5:133358997-133359019 TGTGGAAATTCTCACACGGTGGG + Intronic
997586694 5:135047754-135047776 TTAGGAAACTTTACCACTGTTGG - Intronic
1001096648 5:168780507-168780529 TTTGTAAATTCTCCTACTAAAGG - Intronic
1004934054 6:20490388-20490410 TTTGGAAAAGCTCCCACTGGTGG + Exonic
1005099125 6:22150311-22150333 TTTGGTTAATCTCTCACTGTTGG + Intergenic
1007135370 6:39515807-39515829 TTTAGATATTCTCCTACTGCTGG - Intronic
1007180989 6:39929144-39929166 GTGGGAAATTCTCCCGCGGTGGG - Intronic
1007190452 6:40012077-40012099 TTGGTAAATGCTCCCTCTGTGGG + Intergenic
1008150155 6:47940389-47940411 TTAGGAAAGTCATCCACTGTGGG - Intronic
1009251003 6:61298574-61298596 TTTGGAAATACTCTTTCTGTAGG - Intergenic
1013724257 6:113073811-113073833 TTTTGAAATTTTCCCATTGATGG - Intergenic
1014739762 6:125135250-125135272 TTTAGGAATTCTCCCACAGTTGG + Intronic
1015052973 6:128864047-128864069 TTTTAAAATTCCCCCACTGATGG + Intergenic
1015416110 6:132950511-132950533 TTTGGAATTTTTTCCCCTGTGGG + Intergenic
1015626427 6:135183512-135183534 TTTGAAAATCCTCTGACTGTTGG + Intronic
1016426437 6:143941018-143941040 TTTGAAAATTCTCCCAGATTTGG + Exonic
1017605949 6:156133299-156133321 TTTGGAAATTCAAACATTGTTGG - Intergenic
1018133826 6:160758263-160758285 GGTGTAAATGCTCCCACTGTGGG + Intergenic
1018241523 6:161779909-161779931 TTTGGACATTCTTTCATTGTAGG - Intronic
1018660629 6:166083278-166083300 TCTGGATATTATCCCCCTGTTGG - Intergenic
1022583534 7:31582182-31582204 CTTAACAATTCTCCCACTGTTGG - Intronic
1023202461 7:37713144-37713166 TTTGCAGTTTCTTCCACTGTAGG - Intronic
1023539972 7:41254611-41254633 TTGGGGAATTCTCCCATTGAAGG - Intergenic
1024457745 7:49628248-49628270 TTTGGAAAGTCCTCCAGTGTGGG - Intergenic
1028007017 7:85586233-85586255 TTTGGAAAGTTTCCAACTGAGGG - Intergenic
1028203229 7:87987197-87987219 TTTGGACAGTCTCACTCTGTTGG + Intronic
1030163097 7:106528326-106528348 ATTTGAATCTCTCCCACTGTAGG - Intergenic
1032405352 7:131651896-131651918 TTAGGAAGTTCTCACACTTTCGG + Intergenic
1032995657 7:137443355-137443377 TTTGGAAATTCTCTCATAATTGG - Intronic
1033923949 7:146433425-146433447 TTTGGAAATTCTCCCACTGTCGG - Intronic
1034936042 7:155201632-155201654 TGTGGAAGTTCTGTCACTGTGGG - Intergenic
1035257589 7:157641468-157641490 TTAGGAGATTTTCCCACAGTGGG + Intronic
1035967353 8:4208016-4208038 TTTACATATTCTCCTACTGTTGG - Intronic
1041788005 8:61657338-61657360 TTAGGAAATTTTACCACTGTGGG + Intronic
1042300580 8:67276203-67276225 GGTGGAGATTCCCCCACTGTTGG + Intronic
1042514961 8:69649646-69649668 TTTGTAAAATGTCCCTCTGTTGG + Intronic
1043058417 8:75469297-75469319 TTTACAAAGCCTCCCACTGTGGG - Intronic
1043622190 8:82207939-82207961 TGTGGAGATTATCGCACTGTGGG + Intergenic
1044127427 8:88475027-88475049 TTGGGCAATTTTCCAACTGTGGG - Intergenic
1044568591 8:93692909-93692931 TTTGTAAAATCTCCCCCTATTGG + Intergenic
1044957719 8:97498763-97498785 TTTAGAAATTCTCTAACTGATGG + Intergenic
1045237590 8:100367935-100367957 TGTGGAAAGTCTGCCACTGTGGG - Intronic
1046242884 8:111521314-111521336 TTTGGACATACACCCACTATTGG + Intergenic
1051964642 9:22812661-22812683 TTTGTAAATGCTCCCAGTGATGG + Intergenic
1052246590 9:26343348-26343370 ATTTGAAATTCTCCACCTGTAGG + Intergenic
1053686530 9:40532464-40532486 TTTGGAAATTCTCTTTTTGTAGG + Intergenic
1053936740 9:43164873-43164895 TTTGGAAATTCTCTTTTTGTAGG + Intergenic
1054277255 9:63093394-63093416 TTTGGAAATTCTCTTTTTGTAGG - Intergenic
1054397581 9:64671535-64671557 TTTGGAAATTCTCTTTTTGTAGG + Intergenic
1054432221 9:65176729-65176751 TTTGGAAATTCTCTTTTTGTAGG + Intergenic
1054498164 9:65844947-65844969 TTTGGAAATTCTCTTTTTGTAGG - Intergenic
1055167697 9:73217736-73217758 TTTGGAAAAAGTCCCATTGTAGG + Intergenic
1057293779 9:93823853-93823875 CTGGGGAATTCTCACACTGTTGG - Intergenic
1058954636 9:109934285-109934307 TTGGGAAATTCTTCCTCTGATGG + Intronic
1058983099 9:110188240-110188262 TTTGGAAATTCACCCTCTAATGG - Intergenic
1062552476 9:137095984-137096006 TTTGGAAATATTCCCACCGTGGG + Intronic
1186770232 X:12811056-12811078 TTGTGAAATTCTCCCTCTGCAGG - Intronic
1187046399 X:15651414-15651436 TGTGCAAATTCTGCCACCGTGGG - Intronic
1187052660 X:15709942-15709964 TGTGCAAATTCTGCCACCGTGGG - Intronic
1192089087 X:68133661-68133683 TTTGGAAAATCTATCACAGTAGG - Intronic
1192936769 X:75868808-75868830 TTTAAGAACTCTCCCACTGTGGG - Intergenic
1193547481 X:82847513-82847535 CTTGGTAAGTCTACCACTGTTGG + Intergenic
1195948804 X:110245149-110245171 TTTGGATCTTCTCCCACTGAAGG + Intronic
1197452713 X:126640187-126640209 TTTGGATATTGTCCCAGTGTGGG + Intergenic
1198502524 X:137266145-137266167 TTTGTGAATTCTCTCTCTGTAGG + Intergenic
1198620590 X:138504494-138504516 TTTGCAGATTCTCTCAGTGTTGG - Intergenic
1199439306 X:147850267-147850289 TTTAGAAATTTTCCAACTTTTGG + Intergenic
1200739484 Y:6837720-6837742 TTTTGAAATGCTGCCACTGCAGG - Intergenic
1201296583 Y:12468452-12468474 TGTAGAGATTCTCACACTGTGGG + Intergenic