ID: 1033923953

View in Genome Browser
Species Human (GRCh38)
Location 7:146433443-146433465
Sequence TTTCAATCACAACCCCATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033923953_1033923954 -6 Left 1033923953 7:146433443-146433465 CCAAAATGGGGTTGTGATTGAAA 0: 1
1: 0
2: 1
3: 14
4: 134
Right 1033923954 7:146433460-146433482 TTGAAAATACACATTGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033923953 Original CRISPR TTTCAATCACAACCCCATTT TGG (reversed) Intronic
900265337 1:1754359-1754381 TGTCAATCACCACCTCATTCAGG + Exonic
905558456 1:38906748-38906770 TTTAAAATACAACACCATTTAGG + Intronic
909039580 1:70632854-70632876 TTACAATCACAAACACATGTCGG - Intergenic
909880200 1:80865838-80865860 TTTAATTCACATTCCCATTTGGG + Intergenic
910914086 1:92270755-92270777 CTTCACTCACCACCCAATTTAGG - Intronic
917741556 1:177966416-177966438 TTTAAATCTCAACTCCATCTGGG - Intronic
918463904 1:184802375-184802397 TTTCAATCACAAAGGCAGTTTGG - Intronic
918690209 1:187469688-187469710 TTTAGATCACAATCACATTTTGG - Intergenic
918729275 1:187970600-187970622 TTTCAATCACAAAAATATTTTGG + Intergenic
919252724 1:195079542-195079564 TTTCATTCACTACTCAATTTTGG + Intergenic
920895122 1:210040773-210040795 TTACATACACAAACCCATTTAGG - Intronic
921508697 1:216006059-216006081 TTTCAATCATAATCCCTTTTTGG + Intronic
922074071 1:222225166-222225188 TTTCAATAACAACTCGATATTGG + Intergenic
1064254940 10:13735299-13735321 TTTCAATAACAACCCAGTTTGGG + Intronic
1065819106 10:29508944-29508966 TTTCAATTCCATCCCTATTTCGG - Intronic
1065953715 10:30674993-30675015 TTTCAATTCCAACCCCATTTCGG + Intergenic
1067718765 10:48710547-48710569 GTTCCATCACAAACCCAGTTTGG + Intronic
1069035898 10:63645704-63645726 TTTAAATCACAGAACCATTTGGG - Intergenic
1073520489 10:104123992-104124014 TCTCACTCACAAACTCATTTTGG - Exonic
1078922418 11:15843027-15843049 TTTCATTCATTACCTCATTTAGG - Intergenic
1080109299 11:28547392-28547414 TTGCAATCATAGCACCATTTGGG + Intergenic
1080359736 11:31499016-31499038 TTTGAACCAGAATCCCATTTAGG - Intronic
1081983681 11:47286319-47286341 TTTCAAACACAATCCCAGTTTGG - Intronic
1084183272 11:67457024-67457046 TGTAAATCACATCCCCATTTTGG - Intronic
1084326879 11:68405581-68405603 TTTAAATCACACCCCCATGGAGG - Intronic
1085790643 11:79494291-79494313 TCTCAGTCCCAACCCCATTTTGG + Intergenic
1085825700 11:79844975-79844997 ATTCAATCAAAAACTCATTTAGG + Intergenic
1086661288 11:89421840-89421862 TTTCTTTCATTACCCCATTTTGG + Intronic
1088837659 11:113591436-113591458 ATTCAATCAGAAGCCAATTTTGG - Intergenic
1088910276 11:114185668-114185690 CTGCAATCACCACCCCATTCAGG - Intronic
1091733186 12:2896990-2897012 TTTCAATAACAATACAATTTTGG + Intronic
1091853593 12:3720925-3720947 TTTCCAACACAACCCCATGCAGG + Intronic
1092580219 12:9833574-9833596 TTTCATTCAAAACTCGATTTAGG + Intronic
1092953744 12:13530908-13530930 TTTCCATCACAGTCCCTTTTAGG - Intergenic
1101724507 12:107377869-107377891 CTTCAATGACAGCCCCATTCTGG + Intronic
1102183436 12:110930039-110930061 TTACAATCATAACACCATTCTGG - Intergenic
1104168926 12:126261068-126261090 TGTCAATCAAAACCTCACTTAGG + Intergenic
1107648056 13:42515903-42515925 TATAAATCACAACTCTATTTGGG + Intergenic
1109292851 13:60497293-60497315 TGGCAATGACAACCCCCTTTGGG - Intronic
1110535646 13:76647805-76647827 TTTCATTCACAAAGCTATTTTGG - Intergenic
1115627641 14:35210097-35210119 TTTTAATGACAACCACAATTAGG - Intronic
1120472891 14:84949295-84949317 AATCAATCACAACAACATTTGGG - Intergenic
1126279437 15:46926454-46926476 TTTACAGCACAACCTCATTTAGG - Intergenic
1127750798 15:62040545-62040567 CTTCAATCCCTACCCCTTTTTGG - Intronic
1131667959 15:94590400-94590422 ATTCAATTACAGCCTCATTTTGG + Intergenic
1133767260 16:8846724-8846746 CTTCCATCATGACCCCATTTTGG + Intronic
1135042671 16:19130000-19130022 TGCCTATCATAACCCCATTTTGG + Intronic
1141401808 16:83754349-83754371 TTTCAATCAAAATCCCAGTAGGG + Intronic
1143291218 17:5830677-5830699 TTTCAAACAAATTCCCATTTTGG - Intronic
1145299624 17:21623750-21623772 TCTCAATCACATCACCCTTTTGG - Intergenic
1145350657 17:22079517-22079539 TCTCAATCACATCACCCTTTTGG + Intergenic
1147410901 17:40251488-40251510 TTCCAAGAACAGCCCCATTTAGG - Intronic
1154353448 18:13606235-13606257 TTTCAGGCACAAACCCACTTAGG + Intronic
1154943290 18:21136302-21136324 TCTCAATCAAAATCCCATTAGGG - Intergenic
1155556936 18:27030309-27030331 TTTCAATCTCAACCACATCATGG - Intronic
1158167294 18:54554891-54554913 TTTAAATCTCAACCAGATTTTGG + Intergenic
1158638637 18:59183088-59183110 ATCCAATCACCTCCCCATTTTGG - Intergenic
1158639450 18:59190972-59190994 TATCCATCACATCCCCAGTTAGG - Intergenic
1159792019 18:72793404-72793426 TTTGACTCAGGACCCCATTTTGG - Intronic
1167776115 19:51557966-51557988 TTTCATTCAAAATCCCATTTAGG - Intergenic
926418971 2:12678926-12678948 CCTCAATCCCAACCCCATTGCGG - Intergenic
928839577 2:35588502-35588524 TTTCTATTGCAACACCATTTGGG - Intergenic
930543680 2:52740304-52740326 TTGCAATCAGAACTCCATGTGGG - Intergenic
930863714 2:56102519-56102541 TTTCAATTACAAGCAAATTTAGG - Intergenic
939538596 2:143463806-143463828 ATTCAATCACACACCAATTTAGG - Intronic
939819235 2:146935924-146935946 TTACAATCCCAATTCCATTTTGG - Intergenic
940161015 2:150713669-150713691 TGCCAATCACAACCTTATTTTGG + Intergenic
940669906 2:156654685-156654707 TTATAATCACAACCAAATTTGGG - Intergenic
941270843 2:163426379-163426401 TTTCAATCAGATACCCATTTGGG + Intergenic
942466760 2:176216271-176216293 TTTAATTCACAAATCCATTTAGG + Intergenic
945004786 2:205392956-205392978 TTCCCATCCCAACCCCTTTTTGG - Intronic
945321378 2:208427666-208427688 TTTAAATCACAACAATATTTTGG + Intronic
948639069 2:239362056-239362078 TTTCAAACACAATGCCTTTTAGG + Intronic
1175612925 20:60366621-60366643 TGTTAATCACAAGCCAATTTGGG + Intergenic
1176402094 21:6323075-6323097 TTTCTCTCACACCCCCATCTCGG + Intergenic
1176435063 21:6666029-6666051 TTTCTCTCACACCCCCATCTCGG - Intergenic
1176459325 21:6993099-6993121 TTTCTCTCACACCCCCATCTCGG - Intergenic
1183260291 22:36790392-36790414 TTTCCATCAGAAACCCATTTAGG - Intergenic
957491731 3:80935916-80935938 TATCAATCAGAAATCCATTTAGG - Intergenic
958492378 3:94793567-94793589 TTTAAATCACAACCTCATGCGGG - Intergenic
959328037 3:104962914-104962936 TTTGAATCACAGACTCATTTGGG - Intergenic
959682805 3:109115573-109115595 TTTAAATCACAAGCCCTTCTAGG + Intronic
961909723 3:130302147-130302169 TTTCTATCGCAACACCATTTGGG + Intergenic
962108736 3:132419552-132419574 TTTCAATTTCAACCCTAATTTGG - Intronic
962579205 3:136782458-136782480 CTTCAATCACCAACCCCTTTAGG - Intergenic
964246662 3:154661756-154661778 TTCCCATCTCAACCTCATTTTGG + Intergenic
964523292 3:157589991-157590013 TTGAAATCAAAACCCCATTAAGG + Intronic
965891652 3:173521465-173521487 TTTGAATCACTGCCTCATTTGGG - Intronic
967484033 3:190009211-190009233 TTTCAAACCCCACCCCACTTTGG - Intronic
971692745 4:29858542-29858564 TTTAAATCATGACCACATTTTGG - Intergenic
974192574 4:58525987-58526009 TTTCATTCAAATCCTCATTTAGG - Intergenic
976374571 4:84329718-84329740 TTTCATTCTCAACCCCATCTTGG - Intergenic
976472852 4:85449761-85449783 TGTCAAACACTACCCCATGTGGG + Intergenic
979371993 4:119900116-119900138 TCTAAATCACAACCCCATACAGG + Intergenic
979414972 4:120425825-120425847 ATTCAATCACAAATTCATTTTGG - Intergenic
979509615 4:121537518-121537540 TTCCAAACACAACCACATTGGGG - Intergenic
980270215 4:130574541-130574563 TTTAAATCTCAACCAAATTTTGG + Intergenic
982243380 4:153323288-153323310 TTGCAATCACAAGCTTATTTAGG + Intronic
983090940 4:163501277-163501299 TCTCACACGCAACCCCATTTAGG - Intronic
983582545 4:169323876-169323898 TTCCCACCACATCCCCATTTGGG + Intergenic
986630008 5:9762589-9762611 TTTCACACAGAAACCCATTTTGG - Intergenic
991601547 5:68356012-68356034 TTACAACCATAACCCCAGTTAGG + Intergenic
993109405 5:83637603-83637625 TATCAATGACAAACTCATTTAGG + Intergenic
993452652 5:88091583-88091605 TTTCACTCTCCACCCCATGTTGG - Intergenic
993526077 5:88967517-88967539 TTACAGTCAGAACCCCATTTAGG + Intergenic
993574332 5:89582798-89582820 TCTCAATCTCAACCCTACTTTGG + Intergenic
994451784 5:99952193-99952215 TTGCAATCCCAAACCCATTGTGG - Intergenic
995129512 5:108614991-108615013 TTACATACACAAACCCATTTAGG + Intergenic
996009317 5:118463681-118463703 TTGGAATCTCAACACCATTTTGG + Intergenic
998750546 5:145317170-145317192 TTTCAAGCACATCACCATATTGG + Intergenic
1003869962 6:10393917-10393939 TTTAAAGCACAACTTCATTTGGG + Intronic
1004684740 6:17932190-17932212 TGTCTACCATAACCCCATTTGGG - Intronic
1004930280 6:20456467-20456489 TTTGAATCACATTCCAATTTAGG - Intronic
1006413694 6:33891107-33891129 TTCCAAGCACACTCCCATTTGGG + Intergenic
1008454054 6:51688252-51688274 TGTTAAACACAACCCCATATTGG + Intronic
1008650514 6:53556427-53556449 TTTAGATCTCAACCACATTTTGG - Intronic
1013047207 6:106498414-106498436 ATTGGATCACAACCCCATTCGGG - Intergenic
1014483761 6:121973291-121973313 ATTCAATCATAAGCCCCTTTTGG + Intergenic
1014904246 6:127007287-127007309 TTTCAATCACCAAGCCATTGTGG + Intergenic
1017855034 6:158343270-158343292 TCTAAATCACAACACCATTTTGG - Intronic
1018190192 6:161303927-161303949 TTCCAATCACACCAGCATTTGGG - Intergenic
1019077567 6:169400523-169400545 TTACAATCAGTACCACATTTGGG + Intergenic
1019599261 7:1873328-1873350 CTGTAATTACAACCCCATTTAGG - Intronic
1021455514 7:20825872-20825894 TTTCAAAAACAAACCCATTTGGG + Intergenic
1022856343 7:34318696-34318718 TTTCTATCATGACCCAATTTGGG + Intergenic
1024925847 7:54614664-54614686 TATGAAGCACAACCCCAATTAGG + Intergenic
1026017969 7:66685608-66685630 TTGCATTCTCAACCCCAGTTGGG + Intronic
1030790905 7:113727350-113727372 TTTCAAAAATAACACCATTTTGG + Intergenic
1033923953 7:146433443-146433465 TTTCAATCACAACCCCATTTTGG - Intronic
1038138127 8:24812938-24812960 TATCAATCATCTCCCCATTTGGG + Intergenic
1039311956 8:36326230-36326252 TTTCAATCAGTAACGCATTTTGG + Intergenic
1043467805 8:80529981-80530003 ATTCAATCACAATCCTAATTTGG + Intergenic
1046789636 8:118307275-118307297 TTTCACACACAACAACATTTGGG - Intronic
1050919881 9:11187579-11187601 TTTCTATTGCAACACCATTTAGG - Intergenic
1050989995 9:12138268-12138290 TTTAGATCTCAACCCAATTTTGG - Intergenic
1054847337 9:69810766-69810788 TTTCTATTGCAACACCATTTGGG - Intergenic
1056704432 9:88940065-88940087 TTGCAATGGCAACCCCCTTTGGG - Intergenic
1057467810 9:95331702-95331724 TTTAGATCACAACCAAATTTCGG + Intergenic
1060506915 9:124204672-124204694 TTCCTATCATACCCCCATTTAGG - Intergenic
1060659719 9:125397696-125397718 TTACAATCACAGTCTCATTTTGG + Intergenic
1203436473 Un_GL000195v1:142618-142640 TTTCTCTCACACCCCCATCTCGG + Intergenic
1186018708 X:5228873-5228895 TATGAATCACAATCACATTTAGG + Intergenic
1187616187 X:20995802-20995824 TTTAGATCTCAACCACATTTTGG - Intergenic
1190617396 X:52249620-52249642 TTTCAAAAACAACACCAGTTTGG - Intergenic
1191975134 X:66863275-66863297 TCTCAATCACAAACCCCTTTGGG - Intergenic
1193792453 X:85832081-85832103 TTTCAATCACTACTCCACCTAGG - Intergenic
1194571588 X:95559966-95559988 TTTCTATTGCAACACCATTTGGG - Intergenic
1196881503 X:120202354-120202376 TCTCATTCACAAACTCATTTTGG + Intergenic
1198318605 X:135495453-135495475 TTTCAGTCACAACCACAGCTGGG - Intergenic
1198921177 X:141729614-141729636 TTTCAATTACAATAGCATTTAGG + Intergenic