ID: 1033923954

View in Genome Browser
Species Human (GRCh38)
Location 7:146433460-146433482
Sequence TTGAAAATACACATTGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033923953_1033923954 -6 Left 1033923953 7:146433443-146433465 CCAAAATGGGGTTGTGATTGAAA 0: 1
1: 0
2: 1
3: 14
4: 134
Right 1033923954 7:146433460-146433482 TTGAAAATACACATTGACAAAGG No data
1033923949_1033923954 12 Left 1033923949 7:146433425-146433447 CCGACAGTGGGAGAATTTCCAAA 0: 1
1: 0
2: 1
3: 22
4: 202
Right 1033923954 7:146433460-146433482 TTGAAAATACACATTGACAAAGG No data
1033923946_1033923954 29 Left 1033923946 7:146433408-146433430 CCTTAAACACAATAAAACCGACA 0: 1
1: 0
2: 1
3: 17
4: 213
Right 1033923954 7:146433460-146433482 TTGAAAATACACATTGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033923954 Original CRISPR TTGAAAATACACATTGACAA AGG Intronic
No off target data available for this crispr