ID: 1033927473

View in Genome Browser
Species Human (GRCh38)
Location 7:146481078-146481100
Sequence TACTACTGGCTGGCAGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033927473 Original CRISPR TACTACTGGCTGGCAGTTTC AGG (reversed) Intronic
900539704 1:3196671-3196693 TACTACTGGCTGAGAGTTCCCGG + Intronic
900666252 1:3817454-3817476 CACCAGTGGCTGTCAGTTTCTGG + Intronic
902429342 1:16351363-16351385 TTTTACTTGCTGGCAGTTGCTGG - Intronic
903126456 1:21251541-21251563 AACAACTGGCTCTCAGTTTCTGG + Intronic
912483429 1:110003860-110003882 TACTTCTAGTTGGCAGTTGCAGG + Intronic
914341411 1:146763489-146763511 TAAAACTGGCTGGGACTTTCAGG + Intergenic
917201696 1:172523936-172523958 TATTACAGGGTGGCAGTATCTGG + Intergenic
917962915 1:180158570-180158592 TCCTCCTTGCTGACAGTTTCTGG - Intronic
919547148 1:198938187-198938209 ACCTTCTGACTGGCAGTTTCTGG - Intergenic
919760244 1:201093571-201093593 TTCCACTGGCCAGCAGTTTCTGG - Intronic
1063340008 10:5253941-5253963 TTCTGCTGGCTGGAAGTTTCAGG + Intergenic
1063343728 10:5292710-5292732 TTCTGCTGGCTGGAAGTTTCAGG - Intergenic
1068478098 10:57553646-57553668 TACTACTAGATGGTAATTTCAGG - Intergenic
1074798249 10:116971500-116971522 GACTTCTGGCTAGCGGTTTCAGG + Intronic
1075501610 10:122980183-122980205 TCCTACTGGCTGGCAACTTTCGG + Exonic
1076210519 10:128640011-128640033 TACTTCTGGGTGTCAGTTTCTGG - Intergenic
1076555458 10:131318290-131318312 CACTACTGCCTGGCAGCATCCGG + Intergenic
1078773845 11:14375974-14375996 AACTACTGGGTGGCAGGTACAGG + Intergenic
1079366124 11:19811647-19811669 TCTTAGTGGCTGGCAGTTTCTGG + Intronic
1089022956 11:115236665-115236687 TACTACTGCCTGTCATTTTCTGG - Intronic
1089033918 11:115364662-115364684 TACTACTGACTGACAGTGACAGG - Intronic
1094143431 12:27204331-27204353 TACTACTGGGAGGCATTTACAGG + Intergenic
1100516890 12:95336700-95336722 AAATACTGGCTGTCAGTATCTGG - Intergenic
1104005510 12:124889454-124889476 TACTACTGTCTGGCAGGGGCTGG + Intergenic
1105233573 13:18523722-18523744 TACTACTGCCTGCCAGTGTGGGG + Intergenic
1106463798 13:29995136-29995158 TCCTCCTGTCTGCCAGTTTCAGG + Intergenic
1107182888 13:37482494-37482516 TACTATTGGGTTGAAGTTTCTGG - Intergenic
1108088674 13:46822780-46822802 TACCACTGGCTGACACTGTCTGG - Intergenic
1110273864 13:73620843-73620865 TACTACTAGCTAACAGTTACAGG + Intergenic
1111133469 13:84006446-84006468 TCTTACTGGCTGGCCGTCTCAGG + Intergenic
1113005088 13:105691975-105691997 CATTACTGGCTGGAACTTTCTGG + Intergenic
1114979354 14:28143535-28143557 CACTACTGCCTGGCAATTTCCGG + Intergenic
1116699233 14:48217510-48217532 TACTGCTGGCAGGCATTTTGAGG + Intergenic
1118571141 14:67196683-67196705 TTCCACTGTTTGGCAGTTTCAGG + Intronic
1118860429 14:69658796-69658818 TCCTCCTGGCAGGCGGTTTCAGG + Intronic
1119290599 14:73491932-73491954 TACTACTGTGTGGCAGTTTTTGG + Exonic
1119758921 14:77137963-77137985 TGCTACTGAGTGGCAGTCTCTGG - Intronic
1121270925 14:92637886-92637908 TACTACTGGCTGGGGGTCTTGGG + Intronic
1202942216 14_KI270725v1_random:161968-161990 GACTTCTGGCTGGTAGTTTGAGG - Intergenic
1130436443 15:83904234-83904256 TCACACTGCCTGGCAGTTTCTGG + Intronic
1139992871 16:70953953-70953975 TAAAACTGGCTGGGACTTTCAGG - Intronic
1140570464 16:76100118-76100140 TGCTACAGGCTGGCAGTTGGGGG - Intergenic
1141748409 16:85941828-85941850 TCCTCTTGGCTGACAGTTTCTGG + Intergenic
1149794057 17:59503613-59503635 TACTAGGGGCTGGCTATTTCTGG - Intergenic
1154519451 18:15211731-15211753 TACTACTGCCTGCCAGTGTGGGG - Intergenic
1155505373 18:26527887-26527909 TACTATTTGCTGGCTTTTTCTGG - Intronic
1156051717 18:32944217-32944239 CACTTCTGGCTGGAAGTTTAGGG + Intronic
1164873677 19:31667996-31668018 TACTCCTGGAGGGAAGTTTCTGG - Intergenic
1166408605 19:42541302-42541324 TTCTACTGTCTGGCTGTTTGGGG + Intronic
1166609944 19:44182411-44182433 CACTGCTGTCTGGCAGTGTCTGG - Intergenic
1167737306 19:51303214-51303236 GACTAATGGCTGGTAGCTTCAGG - Intergenic
925473547 2:4188407-4188429 TGGTACTGGCTGGCAGCTTTTGG + Intergenic
926967356 2:18429650-18429672 AGCTACTGGTTGCCAGTTTCAGG - Intergenic
930077220 2:47416310-47416332 TACCACTGGCTCTCAGTCTCTGG + Exonic
930701925 2:54467097-54467119 TACTCTTGGGTGGCTGTTTCAGG + Intronic
937594453 2:123657082-123657104 TAATAGTGGCTGGAAGATTCAGG - Intergenic
938021299 2:127907850-127907872 GACTAATGGCTGGGAGCTTCAGG + Intergenic
938547207 2:132345444-132345466 TACTGCTGGCTGGCAGGCACAGG + Intergenic
946034665 2:216732207-216732229 TACTATGGGTTGGCATTTTCTGG + Intergenic
947247643 2:228067504-228067526 TGCTGATGGCTGGCTGTTTCTGG - Intronic
947608275 2:231504706-231504728 TAGTACTGACTGCCAGTTTGTGG - Intergenic
948642637 2:239385328-239385350 AAGCACTGGCTGGCAGTGTCAGG + Intronic
1169356811 20:4913438-4913460 TGCTACTGGCTGGCAGAACCCGG - Intronic
1169641376 20:7756255-7756277 TGCTACTGACTGGTAGTTGCAGG - Intergenic
1171876078 20:30578203-30578225 TACTGCTGGCTGGCAGGCACAGG + Intergenic
1176580957 21:8524962-8524984 GACTTCTGGCTGGTAGTTTGAGG + Intergenic
1176777557 21:13152005-13152027 TACTACTGCCTGCCAGTGTGGGG + Intergenic
1180883190 22:19221118-19221140 TACTATTGCCTGGCAATTTGAGG - Intronic
1180904311 22:19397936-19397958 CAGTACTGCCTGTCAGTTTCTGG - Intronic
1181832002 22:25567408-25567430 TACCACTGGATGGCAGTTAGTGG + Intronic
1181879036 22:25962777-25962799 AAATACTGGCTGGCAGCTTTGGG + Intronic
1184487017 22:44785878-44785900 TCCTGCTGGCTGCCAGTGTCAGG + Intronic
949493993 3:4614691-4614713 TACAACAGGCATGCAGTTTCTGG + Intronic
950327607 3:12126644-12126666 AACTACTGGGTGGAAGATTCAGG - Intronic
952269723 3:31818964-31818986 TGTTACTGGCAGGCACTTTCAGG + Intronic
952599305 3:35060059-35060081 TAGGACATGCTGGCAGTTTCAGG - Intergenic
953800143 3:46016534-46016556 TATTATTGGCTGGAAATTTCAGG - Intergenic
956689061 3:71859306-71859328 TACTATAGTCTGGCAGTTTTTGG - Intergenic
956814555 3:72896246-72896268 TAACACTTGCTGGGAGTTTCTGG - Intronic
959803249 3:110521085-110521107 TTCTATTGGATTGCAGTTTCTGG + Intergenic
969293495 4:6255397-6255419 CACTCCTGGCTGGCAGTTGGAGG + Intergenic
969972164 4:11059052-11059074 TCCTACTAGCTGGGTGTTTCTGG - Intergenic
970852202 4:20615816-20615838 GACTACTGGCTGGAAGTTCTAGG - Intronic
974389828 4:61251669-61251691 TACTATGGGCAAGCAGTTTCAGG + Intronic
975626386 4:76352706-76352728 TGCTAATGGCTGGCACTTTGTGG - Intronic
980395220 4:132204517-132204539 TAGTACTTGCTGGTGGTTTCTGG - Intergenic
984435545 4:179705875-179705897 TACTACTAGCTGTCAGCTGCAGG - Intergenic
985620659 5:953118-953140 TGCTACTGAGTGGCAGTTTCAGG - Intergenic
991091647 5:62699249-62699271 TACAACAGGATGGCAGCTTCTGG - Intergenic
991445038 5:66690495-66690517 TGCCACTGGCTAGCAGTTTTTGG + Intronic
993699539 5:91101875-91101897 CACTACTGCCTGCCATTTTCTGG + Intronic
994337319 5:98582827-98582849 AACTTCTGGCTCCCAGTTTCTGG + Intergenic
997312612 5:132900648-132900670 TACTATAAGCTGACAGTTTCTGG + Intronic
1000831884 5:166112080-166112102 TACTAATGGCAGGTAGTTCCTGG - Intergenic
1000856341 5:166403220-166403242 TTCTGCTGGCTGGAAGGTTCAGG + Intergenic
1004547954 6:16617057-16617079 TGGTACTAACTGGCAGTTTCAGG + Intronic
1005970033 6:30753502-30753524 TAATTCTGGATGGCAGGTTCAGG - Intergenic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1007671148 6:43554875-43554897 TACTACTGGCTGACATTTGAGGG - Intronic
1007781839 6:44258880-44258902 TCCTACTGGTTGGCAGTTTCAGG + Exonic
1011167160 6:84461954-84461976 AGCTCCTGGCTGGCAATTTCAGG - Intergenic
1016513495 6:144869298-144869320 TACTTCAGGGTGGCATTTTCTGG + Intergenic
1016553412 6:145308481-145308503 TCCTACTGGCTAGCAGTGTTAGG - Intergenic
1017001807 6:150002475-150002497 TACTACTGGGAGCCCGTTTCAGG - Intergenic
1029496969 7:100900885-100900907 TCCAACTGGCTGTCAGTTCCTGG + Intergenic
1029682440 7:102120985-102121007 TACTACAGGCTGGAACTTCCAGG - Intronic
1030313924 7:108094932-108094954 TTCTACTGCTTGGCATTTTCAGG + Intronic
1033927473 7:146481078-146481100 TACTACTGGCTGGCAGTTTCAGG - Intronic
1034919136 7:155065001-155065023 TCCATCAGGCTGGCAGTTTCTGG + Intergenic
1036469018 8:9033445-9033467 TACTACTGTCTGGCCCTTTATGG + Intronic
1038994600 8:32907378-32907400 TATTTCTTTCTGGCAGTTTCTGG + Intergenic
1042026146 8:64425919-64425941 AAATACTGGCTGGCAGTTCGAGG + Intergenic
1043759099 8:84043266-84043288 TAATATTGCCAGGCAGTTTCTGG + Intergenic
1044640335 8:94373493-94373515 CACTGCTGGCTGGCAGATGCAGG + Intronic
1046423909 8:114020802-114020824 TACTTCTTGGAGGCAGTTTCTGG - Intergenic
1048873639 8:138818963-138818985 TACAGCTGGCTGGCAGTGGCTGG + Intronic
1054773570 9:69105569-69105591 TACCACTGGCTGACACTTGCAGG - Intergenic
1058492229 9:105515284-105515306 GACTGCTGGCTGGAAGTTTGTGG + Intronic
1059677628 9:116555000-116555022 ATGTTCTGGCTGGCAGTTTCAGG - Intronic
1193087006 X:77455731-77455753 TACTTCAGGCTGGCAGTTCCTGG - Intronic
1199047538 X:143194081-143194103 TTCTACTGGATGGGATTTTCAGG - Intergenic
1200943190 Y:8806250-8806272 CTGTACTGGCTGGCAGTCTCAGG - Intergenic