ID: 1033930616

View in Genome Browser
Species Human (GRCh38)
Location 7:146515780-146515802
Sequence CCTCCAAATCATGAGGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033930611_1033930616 14 Left 1033930611 7:146515743-146515765 CCACTGGTCCTATGGAAAACTAA 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1033930616 7:146515780-146515802 CCTCCAAATCATGAGGTGTGAGG 0: 1
1: 0
2: 1
3: 7
4: 129
1033930612_1033930616 6 Left 1033930612 7:146515751-146515773 CCTATGGAAAACTAAGTATGAGC 0: 1
1: 2
2: 1
3: 7
4: 102
Right 1033930616 7:146515780-146515802 CCTCCAAATCATGAGGTGTGAGG 0: 1
1: 0
2: 1
3: 7
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033930616 Original CRISPR CCTCCAAATCATGAGGTGTG AGG Intronic
901313496 1:8288814-8288836 CCTCCACCTCATGAAGTGTTGGG + Intergenic
901619186 1:10568682-10568704 CCTCAAATTCATGATGTCTGAGG - Intronic
904678244 1:32211721-32211743 CCTCCAAATCAGGAGAGTTGGGG - Intronic
905463913 1:38138854-38138876 CCTCCAAAGAATGAGGGGTTTGG - Intergenic
906802419 1:48749660-48749682 CCCCACAATCATGAGGGGTGCGG + Intronic
911196833 1:95003311-95003333 CTTCCAAAACATGAAGTGTGAGG - Intronic
912564739 1:110579639-110579661 CCTCCCAATCAATAGCTGTGTGG - Intergenic
915112497 1:153573360-153573382 TCTCCAAATAATGAGGAATGTGG + Intergenic
916172674 1:162012407-162012429 CCACCAAAGCTTTAGGTGTGGGG + Intronic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
923969971 1:239189408-239189430 CCTCCAAATTCTGAGATTTGAGG + Intergenic
924577578 1:245294234-245294256 CCTCCAAGTCATAAAGTGAGAGG + Intronic
1063058196 10:2525210-2525232 CCTTCAGGTCATGAGGTCTGGGG - Intergenic
1064352593 10:14590075-14590097 TCTACAAATCATTAGCTGTGTGG + Intronic
1066988257 10:42487440-42487462 CCTCCTCATCATGATCTGTGTGG - Intergenic
1067928233 10:50532725-50532747 CTTCCAAATCATGAATTTTGCGG - Intronic
1068912768 10:62396144-62396166 CCTATAAATGATGAGGTTTGGGG - Intronic
1069868999 10:71521765-71521787 CCTCCAAATCCAGAGGAGAGAGG - Intronic
1070828613 10:79405398-79405420 CCTGCAAAGGGTGAGGTGTGAGG + Intronic
1070877885 10:79831379-79831401 ACTCCAAATAATGAAGTGTTTGG + Intergenic
1071644386 10:87347420-87347442 ACTCCAAATAATGAAGTGTTTGG + Intergenic
1072800171 10:98387224-98387246 TCTCCAAATCTGGTGGTGTGAGG + Exonic
1073806513 10:107104477-107104499 ACTCCAGATCCTGAGGTGAGAGG - Intronic
1074255679 10:111800063-111800085 CCTCCAACTCAGAAGGTGTCTGG - Intergenic
1079522443 11:21343920-21343942 CCTCCAAATCATCATGTGCCAGG + Intronic
1081242969 11:40729527-40729549 CCTCCATATCATGCTGTGTAAGG - Intronic
1089540506 11:119186789-119186811 CTTCTAAATCCTGGGGTGTGGGG - Intronic
1090411375 11:126512075-126512097 CCTCCATTTCATGAGATGAGGGG + Intronic
1091106349 11:132922963-132922985 CCTCCAAAGGCTGAGGTGGGAGG + Intronic
1096202505 12:49695090-49695112 ACTCCAAAGGATGAGGTGGGAGG + Intronic
1096440881 12:51643005-51643027 ACTCCAAATCAAAAGCTGTGAGG - Intronic
1101266512 12:103093927-103093949 TCTCCAACTCAAGAGGTGAGTGG - Intergenic
1102802933 12:115752479-115752501 CCTCAAAATCGGGGGGTGTGGGG - Intergenic
1108266633 13:48715866-48715888 CCTGCAAATCATGTGCAGTGAGG + Intergenic
1112128200 13:96493225-96493247 CCTCCAAATGATGAATTGTCTGG - Intronic
1114130829 14:19789826-19789848 CTTCCAAATTTTGAGGTATGGGG + Intronic
1115467424 14:33731055-33731077 CCACCAAATCCTGATGTGTGAGG - Intronic
1118763497 14:68894981-68895003 CCACCAAATCATGTGCTTTGTGG + Intronic
1124692670 15:31838753-31838775 CCTCAAAATCAGGAGTAGTGGGG - Intronic
1126009411 15:44288723-44288745 CCTCCCAACCGTGAGGTGTTGGG + Exonic
1126812469 15:52421602-52421624 CCTGGAAATCAAGAGATGTGGGG - Intronic
1127936211 15:63641371-63641393 CCTTAAAAGCATGAGGTCTGAGG - Intronic
1129157729 15:73729128-73729150 GCTCAAAAGCATGAGGTCTGAGG + Intergenic
1129647924 15:77454969-77454991 CCTCTCAATTATGAGGTGTATGG + Intronic
1130143546 15:81253926-81253948 CCTCCATATCAGGAGATCTGTGG + Intronic
1131949581 15:97666579-97666601 CCTCCAAATCAGGGGGAGAGAGG - Intergenic
1136463078 16:30424103-30424125 CCTCCACTTCTTGAGGTCTGAGG - Exonic
1137590239 16:49689035-49689057 CCTCCAAATCCTCACCTGTGTGG - Intronic
1139016683 16:62697827-62697849 CCTCCAAACCATCTAGTGTGAGG - Intergenic
1139515099 16:67448047-67448069 CCTCCATATCAAGATGAGTGAGG + Intronic
1141373984 16:83512834-83512856 GTTCCAAATCAAGAGGTTTGTGG - Intronic
1143480217 17:7223842-7223864 CATCCAAATCATGGGGGGTATGG + Exonic
1144969272 17:19097241-19097263 CCTCCCAATCATGTTTTGTGTGG - Intergenic
1144978644 17:19154824-19154846 CCTCCCAATCATGTTTTGTGTGG + Intronic
1144989578 17:19223408-19223430 CCTCCCAATCATGTTTTGTGTGG - Intronic
1146982590 17:37178940-37178962 CTTCTAAATAAAGAGGTGTGAGG - Intronic
1147747778 17:42705965-42705987 CCTCCATTTTATGTGGTGTGGGG + Intronic
1148904181 17:50901091-50901113 CTTCCAAATCATGAAGTATGAGG - Intergenic
1151530095 17:74698568-74698590 CCTGCAGCTCATCAGGTGTGTGG - Intronic
1153348552 18:4054024-4054046 CCTGACAATCATGAGGGGTGAGG + Intronic
1153810135 18:8745050-8745072 TCTCAAAATCAGGAGGTGGGAGG - Intronic
1158192924 18:54850927-54850949 CCTCCTACTCATTAGCTGTGTGG + Intronic
1158817022 18:61113469-61113491 CCTCCATATCCTGAGATTTGGGG - Intergenic
1159774394 18:72586098-72586120 CCTCCAACTCAGAAGGGGTGGGG + Intronic
1160218361 18:76953900-76953922 CCTCCCAAGCATGAGGAGTGTGG - Intronic
1164644411 19:29847612-29847634 CCTCCAAATCATAAGCTGAAAGG + Intergenic
1167517828 19:49933424-49933446 CGTCCAAATCATGAAATGTTTGG + Exonic
932441416 2:71738351-71738373 TCTCCAAATCATTAGGTGTGTGG + Intergenic
933775467 2:85768818-85768840 CCTCAAAGTCATGATCTGTGAGG - Intronic
936694251 2:114928067-114928089 TCTCCAACTTATGAGGTTTGGGG + Intronic
941618955 2:167755492-167755514 CCTCCAATCAATGAGGGGTGAGG + Intergenic
943190886 2:184679429-184679451 CCACCAACTCATAAGGGGTGGGG - Intronic
943470594 2:188290493-188290515 CCTCCAAACCATGAGATTTGGGG + Intergenic
944478992 2:200135868-200135890 CCCCCAAATGATGGGGTATGGGG - Intergenic
944503845 2:200389808-200389830 CCAACAAATCATGAGAAGTGGGG - Intronic
946347219 2:219120589-219120611 CCTGTAAATCTTGAGGTCTGAGG - Intronic
1174579635 20:51562566-51562588 CCTCCGCATCATGGGGTCTGTGG - Intronic
1179057302 21:37948014-37948036 CCTGTAACTCATGAGGAGTGAGG + Intergenic
1180740730 22:18051526-18051548 CCCCCAAAACCTGAGGTGGGAGG + Intergenic
1182054283 22:27337817-27337839 CCTCAGAATGATGAGGTGTGCGG + Intergenic
1183263333 22:36810460-36810482 CCTCAAAAGCATGAAGTGTGGGG + Intronic
949131263 3:503769-503791 CTTCTAGATCCTGAGGTGTGTGG + Intergenic
956379888 3:68654351-68654373 CCCCTAAAACATGTGGTGTGGGG + Intergenic
957386614 3:79503588-79503610 CCTCCAACACAGGAGCTGTGTGG - Intronic
964969796 3:162545358-162545380 TTTCCAAATCAGGAGGAGTGTGG + Intergenic
969114937 4:4865631-4865653 CCCCCAAATCCTGGGGTGTAGGG - Intergenic
974333051 4:60504919-60504941 CCTGCAGGTCATGTGGTGTGGGG + Intergenic
975532988 4:75420385-75420407 TCTCCCATTCAGGAGGTGTGGGG + Intergenic
977189997 4:93987405-93987427 AGTCCTAATTATGAGGTGTGAGG - Intergenic
985265233 4:188150753-188150775 CCTGCCACTGATGAGGTGTGTGG + Intergenic
986415831 5:7527124-7527146 CCACCACAACATGAGGTGGGTGG - Intronic
989661139 5:43798596-43798618 ACTCAAATTCATGAGGTGTTGGG + Intergenic
991248312 5:64531462-64531484 CTTCCAAATTAGGAGGTCTGTGG + Intronic
993369981 5:87080825-87080847 CCTTCAAACCATGAGTTGTTTGG + Intergenic
996349870 5:122526911-122526933 CCTTTAAATAATGAGGTGGGTGG + Intergenic
996519253 5:124408673-124408695 CCTCCATGCCATGAGGTGTAGGG + Intergenic
998049185 5:139017215-139017237 CCAACAAAGCATGAGGTGAGAGG + Intronic
999350918 5:150870932-150870954 GCTCCAAATTATGAGGAATGAGG + Intronic
1000179338 5:158792675-158792697 CCTCAAGATCATGTGGTCTGGGG + Intronic
1003007476 6:2395042-2395064 CATACAAATCATGTGCTGTGGGG + Intergenic
1007008519 6:38391938-38391960 TATCCAAATCTTGAGTTGTGTGG - Intronic
1007554762 6:42756581-42756603 CATCCTAAACATGAGGTGTTTGG - Intronic
1007603839 6:43102092-43102114 CCTCCAACTCTGGAGGTGGGTGG + Intronic
1013072397 6:106740995-106741017 CCTCCAAACCATGCGGTCTTTGG + Intergenic
1017475154 6:154783087-154783109 TCACCAAATCATGAGGTCTCTGG - Intronic
1018481912 6:164199565-164199587 CCTCCAAATCAAGAGCTCAGGGG + Intergenic
1019148817 6:169990878-169990900 CCTCCAAACCTTGAGGTCCGCGG - Intergenic
1021928241 7:25553847-25553869 CCTGGAAATCATGAGGTATCCGG - Intergenic
1025624243 7:63205264-63205286 CCTCCCACACATGATGTGTGTGG + Intergenic
1025956607 7:66187924-66187946 CCTCCAAACCTGGAGGAGTGTGG + Intergenic
1027795900 7:82693364-82693386 ACTCCAAAGGCTGAGGTGTGAGG + Intergenic
1033930616 7:146515780-146515802 CCTCCAAATCATGAGGTGTGAGG + Intronic
1034938020 7:155212184-155212206 CTTCCTAATCTTGAGATGTGTGG + Intergenic
1035166577 7:156993950-156993972 CGTGGAAATCTTGAGGTGTGGGG + Intergenic
1035560144 8:598204-598226 CCACCCACGCATGAGGTGTGTGG - Intergenic
1036972179 8:13367296-13367318 CATCCAGATCATGAACTGTGAGG + Intronic
1038169332 8:25114625-25114647 CCTCTGAAGGATGAGGTGTGTGG - Intergenic
1039435555 8:37557045-37557067 TCTGCCAATCATGAGCTGTGTGG + Intergenic
1040110428 8:43564783-43564805 CCCCCAAACCCTGAGGTGGGAGG + Intergenic
1043545347 8:81308984-81309006 CCTCAAAATCATGAAATATGTGG + Intergenic
1044588206 8:93887879-93887901 GCTCCACATCATGAGTTGTTAGG + Intronic
1047214644 8:122866326-122866348 GCTCCAAATCCTGGGGTGGGGGG - Intronic
1052519729 9:29531041-29531063 ATACCAAATCCTGAGGTGTGGGG - Intergenic
1056154955 9:83824961-83824983 TCTCCAAATATTGAGGTTTGGGG - Intronic
1056355768 9:85799947-85799969 TCTCCAAATATTGAGGTTTGGGG - Intergenic
1056375983 9:86011465-86011487 CCTCCGAATGCTGAGGTGGGAGG - Intronic
1057757210 9:97848079-97848101 CGCCCAAAGCATGAGGTGGGCGG - Intergenic
1058359185 9:104122483-104122505 ACTAGAAATCATGAGGTCTGAGG - Intronic
1059382687 9:113939529-113939551 TTTCTAAATCGTGAGGTGTGAGG - Intronic
1059920067 9:119150460-119150482 CCCCCAAACCAGGAGGTGAGTGG + Intergenic
1061740672 9:132703193-132703215 CCTGCAAATCATGTGCAGTGAGG - Intergenic
1187095180 X:16140631-16140653 CCACCAAAGGATGAGGTGGGTGG - Intronic
1191975206 X:66863943-66863965 GCCCCAGATCAGGAGGTGTGAGG - Intergenic
1193438627 X:81511998-81512020 CTTGCAGATGATGAGGTGTGAGG - Intergenic
1194036315 X:88876615-88876637 CCAACAAATCATGTTGTGTGAGG - Intergenic
1197922218 X:131607465-131607487 ACTCCAAACCATGAGGGGAGAGG + Intergenic
1198416685 X:136427313-136427335 CCCACAAATGATGAGGTGAGGGG - Intergenic
1202038655 Y:20660556-20660578 CCTCCAGATCATGACATGTTAGG - Intergenic