ID: 1033946960

View in Genome Browser
Species Human (GRCh38)
Location 7:146730911-146730933
Sequence ACATCAGCTTCCATTTTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 267}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033946959_1033946960 24 Left 1033946959 7:146730864-146730886 CCACATTGATGAATAATAATCAA 0: 1
1: 0
2: 7
3: 22
4: 311
Right 1033946960 7:146730911-146730933 ACATCAGCTTCCATTTTCAAAGG 0: 1
1: 0
2: 1
3: 27
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033946960 Original CRISPR ACATCAGCTTCCATTTTCAA AGG Intronic
900577028 1:3388496-3388518 ACCTCAGCCCCCATTTTCAAAGG + Intronic
901469493 1:9446384-9446406 AAATCAGGCTCCATTGTCAACGG - Intergenic
901964215 1:12852812-12852834 ACATGAGGTTCTATTATCAAAGG + Intronic
902313312 1:15598767-15598789 AAAACAGTTTCCATATTCAATGG + Intergenic
902602310 1:17548517-17548539 ACATAAATTTCCATTTGCAAAGG - Intronic
903356235 1:22749573-22749595 ACATCAGCTCCCATTGCCAGGGG + Intronic
904406091 1:30289060-30289082 AAAGCAGCTTCCACTGTCAAGGG - Intergenic
905560262 1:38920929-38920951 ACATCAGTTTCCAGTTTGAGGGG + Intronic
906163215 1:43666545-43666567 ACATCAGCTCACCTTGTCAAAGG - Exonic
907554725 1:55334178-55334200 CCATCAGCTTCCATCTCCTAAGG - Intergenic
910385299 1:86675971-86675993 ACATCAGCTTCCATGTTGTGAGG + Intergenic
911349681 1:96737776-96737798 AAAGCAGGTTCAATTTTCAAAGG - Intronic
911813989 1:102320019-102320041 ATCTGATCTTCCATTTTCAAAGG - Intergenic
912320532 1:108708728-108708750 ACCTCAGCTGCCAGTTCCAATGG + Intergenic
912972850 1:114300275-114300297 TCAGAACCTTCCATTTTCAAAGG + Intergenic
913288120 1:117246158-117246180 AAATTAGTTTCCATTTTCAAGGG + Intergenic
915775166 1:158475866-158475888 ATATCAGTTTAAATTTTCAACGG - Intergenic
917417444 1:174825510-174825532 ACATCTGCATTCATTTTCTAGGG + Intronic
918334044 1:183489758-183489780 AGATCAACTTCTATTCTCAATGG + Intronic
921077449 1:211711499-211711521 ACATGTGCTTTCATTTTCTAGGG + Intergenic
921117059 1:212102021-212102043 GCATCATCTGCCATTTTAAAGGG + Intronic
921185786 1:212668135-212668157 ACATAAACTTCCTATTTCAAAGG - Intergenic
923227616 1:231953793-231953815 CCTTTGGCTTCCATTTTCAAAGG + Intronic
923795694 1:237153004-237153026 ACACCAGCAGCCATTTTCTAAGG + Intronic
923888225 1:238181449-238181471 ACAGCAGCTTCCATGTACATGGG + Intergenic
924169376 1:241321478-241321500 ACATCAGATTCACTTTCCAAAGG + Intronic
924544572 1:245014533-245014555 ACACAACCTTCCATTTTTAATGG - Intronic
1062783887 10:243941-243963 ACATCAGATTACATTTTCAGAGG + Intronic
1065226263 10:23546593-23546615 ATATCAGCTTCTACTTTGAAAGG - Intergenic
1067404185 10:46005717-46005739 AGCTCAGCTTCCATTTACACAGG + Intronic
1068867074 10:61905264-61905286 ACATCAGCATCCATTTCGAAAGG + Intronic
1069250375 10:66259169-66259191 ACAGCAACTTCCATTTACATGGG + Intronic
1069406920 10:68111228-68111250 AAATCAGGTTCCATTTTGAAAGG + Intronic
1069934490 10:71905934-71905956 CCATCAGCATCCATTTACAGCGG - Intergenic
1070226003 10:74506553-74506575 GCATCAGATGTCATTTTCAATGG + Intronic
1071584422 10:86805759-86805781 CCTTCAGCTTTCATTTTCTAAGG + Intronic
1074194222 10:111166669-111166691 AGATCAGCTTAAATTTTGAAGGG + Intergenic
1074793739 10:116919876-116919898 AAATCAGCTTTCATTTGTAATGG + Intronic
1076437546 10:130456380-130456402 TCATCAGCTAATATTTTCAATGG - Intergenic
1077558006 11:3235651-3235673 CCATCAGCTTCCATTTTCTTGGG - Intergenic
1079705365 11:23609986-23610008 ACATGATTTTCCATTTTCAGTGG + Intergenic
1080030425 11:27655134-27655156 ACATTTACTTACATTTTCAATGG + Exonic
1082705370 11:56487959-56487981 ACTTCATCTTACATTTTTAAAGG + Intergenic
1083636354 11:64122933-64122955 ACTTGAGCTGCCATTTTCAAGGG - Intronic
1083700976 11:64477505-64477527 ACAACAGCTTCCATTTATCAAGG - Intergenic
1085569844 11:77549969-77549991 ACAGCAACTTCCATTTGCATGGG + Intronic
1085893947 11:80614529-80614551 TCATCAGCTTTTATGTTCAAGGG + Intergenic
1087357572 11:97114112-97114134 ACATCAGGATCCATTTCCAAAGG + Intergenic
1087535795 11:99443517-99443539 ACATCAGTTTGCATTTTTCATGG - Intronic
1087800453 11:102497968-102497990 CCAGCAGCTGCCATTTTCCAGGG + Intronic
1090601151 11:128372927-128372949 ATATCAGGTTTTATTTTCAAAGG - Intergenic
1091580363 12:1783742-1783764 AAATTAGCTTCCAGTTTTAAAGG - Intronic
1093074066 12:14739243-14739265 ACAGCAACTTCCATTTACATGGG + Intergenic
1093744635 12:22725998-22726020 GCAGCAGCTTCCATTATTAAAGG + Intergenic
1093990184 12:25581304-25581326 ACATCTGGATTCATTTTCAATGG + Intronic
1094354825 12:29566240-29566262 ACATCACCTTCCTGTTTCAGGGG - Intronic
1094482546 12:30896290-30896312 ACTTCCGTCTCCATTTTCAAAGG + Intergenic
1095288791 12:40449901-40449923 AGAACATCTTCCCTTTTCAAAGG + Intronic
1098292084 12:68966010-68966032 ACATGACTTTCCATTTTTAATGG - Intronic
1098407047 12:70137823-70137845 ACAGCAACTTCCATTTACATGGG - Intergenic
1101133494 12:101713705-101713727 ACCTCTGCTTCCATTCACAATGG - Intronic
1101511766 12:105399595-105399617 AAAGCAGCTCTCATTTTCAATGG - Intergenic
1101970865 12:109310797-109310819 AGATCAGCTTTCATTCTCTAGGG + Intergenic
1108069976 13:46618395-46618417 ACAACAGTTTCCATTAACAATGG - Intronic
1109030994 13:57187339-57187361 ACAGCAGCTTTCATTTGTAAAGG - Intergenic
1110188277 13:72700704-72700726 TCTTCAGCTTCCCATTTCAAAGG - Intergenic
1110718490 13:78734624-78734646 AGATCAGTTTCAATCTTCAATGG - Intergenic
1112303062 13:98247686-98247708 ACCCCAGCTTCCACCTTCAACGG + Intronic
1112355504 13:98671735-98671757 ACATGAGTTTCCAGTTTGAAAGG + Intergenic
1112418099 13:99221645-99221667 CCATCAGCTTCCATCCTCAATGG - Intronic
1112554577 13:100454679-100454701 ACATGATCTTCAATGTTCAAAGG + Intronic
1113199319 13:107848497-107848519 ACAGCTGCTTGCATTTTGAAGGG - Intronic
1114606787 14:24004560-24004582 AAGTCAGCTTCCCTTTCCAAAGG + Intronic
1114612089 14:24049508-24049530 AAGTCAGCTTCCCTTTCCAAAGG + Intergenic
1115763151 14:36595942-36595964 ACATCAGATTCGATTGTCAATGG - Intergenic
1116650407 14:47584652-47584674 AAATCATCCTCCATTTTTAAAGG + Intronic
1117496160 14:56307348-56307370 GGAGCAGCTTCCATTTGCAAAGG - Intergenic
1118422701 14:65624443-65624465 AGATCAGCTTTCATTCACAATGG + Intronic
1118448849 14:65878692-65878714 AGCTCAGCTTCCATTTACACAGG + Intergenic
1118464478 14:66018268-66018290 AGCTCACCTTCCATTTTAAAGGG + Intergenic
1118719878 14:68586429-68586451 ACATGAGCTTGCATTTCCATGGG - Intronic
1119155438 14:72405835-72405857 TAATCAGCTTTCAGTTTCAATGG + Intronic
1119916872 14:78410476-78410498 ACATAAGCTGGCTTTTTCAATGG + Intronic
1120063417 14:80011772-80011794 TAATAAGCTTCCATTTTGAAAGG - Intergenic
1120558770 14:85963370-85963392 AAATATGCTTCAATTTTCAAAGG - Intergenic
1120622366 14:86779892-86779914 ACATCTATTTACATTTTCAAAGG - Intergenic
1121157959 14:91704741-91704763 AAAGTAGCATCCATTTTCAAGGG - Intronic
1123151076 14:106182295-106182317 CCACCAGCTTGCACTTTCAACGG + Intergenic
1123399491 15:19970177-19970199 CCACCAGCTTGCACTTTCAACGG + Intergenic
1123797316 15:23784683-23784705 ACTTCAGCTCACATTCTCAAAGG + Intergenic
1125445273 15:39747692-39747714 AACTCAGCTTCCATTTTTATAGG + Intronic
1127041492 15:54981982-54982004 ACCTCAGCCTACATTTTCAATGG + Intergenic
1129534344 15:76299748-76299770 ACAGCAGCTTCCATTGTGATAGG - Intronic
1133804136 16:9110402-9110424 AAATGAGCTTCCCTTTTCTAGGG - Intronic
1136672458 16:31870989-31871011 AGATCAGATTCCATTTTGACTGG - Intergenic
1137963204 16:52906397-52906419 TCAGGAACTTCCATTTTCAATGG + Intergenic
1138855877 16:60690725-60690747 ACATCAGCTTTCATTTCCTATGG + Intergenic
1139104459 16:63810436-63810458 ACATAGGCTTTCATTTTTAAAGG + Intergenic
1140756848 16:78075389-78075411 ATCTCTGCTTCCATCTTCAATGG - Intergenic
1140898194 16:79344108-79344130 ACACCAGCTTCCATCTTCCAGGG - Intergenic
1141573332 16:84947996-84948018 GCATCAGCACCCATTTACAAAGG + Intergenic
1141598717 16:85112629-85112651 ACAAGAGCCTCCATCTTCAAAGG - Intergenic
1141809736 16:86367821-86367843 ACATCTGCTCCCCTTTTCCAGGG + Intergenic
1203117953 16_KI270728v1_random:1510311-1510333 ACATCAGCTGAAATTTACAAAGG - Intergenic
1144241172 17:13313964-13313986 ACATGAGTTTCCAGATTCAAAGG - Intergenic
1145296819 17:21599100-21599122 ATACCAGCTTCCCTTTCCAAAGG + Intergenic
1146448154 17:32949773-32949795 ACATCACGTCCCATGTTCAATGG - Intergenic
1146643353 17:34557820-34557842 ACAACAGCCTGCATATTCAAGGG + Intergenic
1147569556 17:41560255-41560277 ACATGAGCTTCCATTCTAACTGG - Intergenic
1147869258 17:43575987-43576009 ACATCAGGCTCCATCTTCACAGG - Intronic
1149734125 17:58976243-58976265 ATATCAGCTACCATTTTCTCAGG - Intronic
1149941747 17:60877378-60877400 ACAGAAGATCCCATTTTCAAAGG - Intronic
1150044832 17:61902248-61902270 ACATGAGTTTCCAGGTTCAAAGG - Intronic
1150699862 17:67437360-67437382 ACTTCTGCCTCCATGTTCAAGGG - Intronic
1151341615 17:73474818-73474840 ATATCTGATTCCATTTCCAAAGG - Intronic
1153052631 18:914574-914596 AGAGTAGCTTCCATTGTCAAAGG + Intergenic
1153233051 18:2958868-2958890 CCTTCAGGTTCCATTTTGAAAGG + Intronic
1153289508 18:3486500-3486522 ACAGAAGCTGCCATTTTCTAAGG - Intergenic
1154055326 18:11007784-11007806 ACATTTGCCTTCATTTTCAAAGG - Intronic
1155272534 18:24154526-24154548 ACATCAGCAGCCAATGTCAAAGG + Intronic
1155914494 18:31542616-31542638 AGCTCTGCTTCCATTGTCAAAGG + Exonic
1156943068 18:42794546-42794568 ACATGAGCTTACATTTTTTAAGG + Intronic
1158052685 18:53242180-53242202 ACAGCAGCTGCAAATTTCAAGGG + Intronic
1158467670 18:57705574-57705596 ATCTCTGCTTCCATCTTCAAGGG - Intronic
1158684869 18:59604373-59604395 GCATCATCTTCCATTTTCACAGG + Intronic
1159648003 18:70942803-70942825 ACATCAGCTTGCATTGCCAAGGG + Intergenic
1164278870 19:23750756-23750778 ATTTCAGCTCCCATGTTCAAGGG - Intronic
1167511503 19:49897567-49897589 ACAGCAGCTGGCATTTCCAAAGG - Intronic
926308894 2:11660195-11660217 GCATCAGCCTCCCTTTGCAATGG - Intronic
929385430 2:41401151-41401173 TCCTCAGGGTCCATTTTCAAGGG - Intergenic
934218940 2:90063696-90063718 ACATAATCTTCAATTCTCAAAGG - Intergenic
937724160 2:125140393-125140415 ATATAAGCTTTCATTTTTAATGG - Intergenic
938591013 2:132736226-132736248 ATATAAACTTCCATTTCCAAAGG - Intronic
939282337 2:140080166-140080188 TCATAGGTTTCCATTTTCAATGG - Intergenic
939329695 2:140741194-140741216 ACATCAGCTTCACATTTCCAGGG + Intronic
939992337 2:148887696-148887718 AATTCAACTTCCATTTTCGATGG + Intronic
940063922 2:149605177-149605199 ACATGAGTTTCCATATTGAAAGG - Intergenic
940136884 2:150447280-150447302 AGTTCAGCTTTCATTTTAAAAGG - Intergenic
940164126 2:150749694-150749716 ACCTCTGCTTCCAGGTTCAAGGG - Intergenic
941411442 2:165161546-165161568 ACACCAGTTTCCCTTTTTAAAGG + Intronic
941424387 2:165323507-165323529 ACATCAGCTGCAATTTTAATTGG - Intronic
942120987 2:172777060-172777082 AGATCAGCTTCCATTTTCCTAGG + Intronic
942548978 2:177094746-177094768 GCCTCAGCTTCAACTTTCAAGGG - Intergenic
942593907 2:177574270-177574292 ATATCACCTTCTATATTCAATGG + Intergenic
942819215 2:180091400-180091422 ACATCAGCAGCCATATTTAACGG + Intergenic
943088571 2:183346849-183346871 AAAACAGCTTCAAATTTCAATGG + Intergenic
943771453 2:191722021-191722043 TTAGCAGCTTACATTTTCAAGGG + Intergenic
946567580 2:220984067-220984089 AAATCAGATTCCATTTTCTCAGG + Intergenic
948599280 2:239099260-239099282 ACACCTTCATCCATTTTCAAAGG - Intronic
1169082104 20:2803862-2803884 ACAGCAACTTCTATTTTCATGGG + Intergenic
1169472761 20:5902388-5902410 AGTTCAGCTTCATTTTTCAATGG + Intergenic
1169732846 20:8804916-8804938 ACATCACCTTCCGGGTTCAAGGG - Intronic
1174272341 20:49378748-49378770 ACAGAATCTTCCTTTTTCAATGG - Intronic
1174976862 20:55345490-55345512 GCATGAGCTTCCATTCTAAAGGG + Intergenic
1175430266 20:58896813-58896835 GCTTCAGCTTCCATTTCAAAAGG + Intronic
1175654482 20:60757013-60757035 ACTTGTGCTTCTATTTTCAAAGG - Intergenic
1177505443 21:22013330-22013352 ACATGAACTTCCATTCACAAAGG - Intergenic
1177843217 21:26257794-26257816 ATATTAACTTCCATTTCCAATGG + Intergenic
1178174330 21:30078710-30078732 ACTCCAGCTTCCTTTTTCTAGGG - Intergenic
1181632633 22:24159284-24159306 ACGTCAGCAGCCAGTTTCAAGGG - Intronic
1182820826 22:33214728-33214750 CCTTCAGGTTCCATTTTCGAGGG + Intronic
1183005861 22:34901452-34901474 ACATCATTTTCACTTTTCAAGGG - Intergenic
1183217509 22:36490390-36490412 AGGTCAGCTCCCAGTTTCAAGGG - Intronic
1184329222 22:43815674-43815696 ACAGCAGTTGCCCTTTTCAACGG - Intergenic
1184794989 22:46726998-46727020 ACATTAGCTACAATTTTAAAAGG + Intronic
1184814728 22:46860894-46860916 ACATCAGCTTCCACTTCCTTTGG + Intronic
949370785 3:3332662-3332684 ATGTCAGTTTCCATTTGCAAAGG - Intergenic
949480588 3:4491209-4491231 AAAACCTCTTCCATTTTCAAAGG - Intergenic
950137575 3:10592521-10592543 ACTCAAGTTTCCATTTTCAAGGG - Intronic
952851510 3:37733460-37733482 AAAATAGCTTCCATTTCCAAAGG - Intronic
953361032 3:42296860-42296882 ATATCAGCTTCAATTTTGAGGGG + Intergenic
954762556 3:52887213-52887235 ACTTCAGCATGCATTTTCTAAGG - Intronic
954796837 3:53165768-53165790 TCTTCAGCTTCCAGATTCAAGGG + Intronic
954936428 3:54331033-54331055 ACATGAGCATTCATTTTCATGGG + Intronic
955204569 3:56884185-56884207 GCATTAGCTTCTATTCTCAAAGG + Intronic
955582090 3:60434563-60434585 ACATCAGGTAGCATTTTCAGTGG - Intronic
957407875 3:79795424-79795446 ACATTTGTTTCCATTTTTAAAGG + Intergenic
957448207 3:80341544-80341566 ACATAAATCTCCATTTTCAAAGG - Intergenic
957800954 3:85080569-85080591 ACCTCAGGTTCCTTTCTCAATGG + Intronic
959263653 3:104112162-104112184 TCATCAGCTTCTTTTTTGAAAGG + Intergenic
959380202 3:105632277-105632299 ACATCATGTCCCATGTTCAATGG - Intergenic
961229502 3:125290708-125290730 ATATCAGATTTCCTTTTCAAAGG + Intronic
962600639 3:136988379-136988401 ACATCATCTTCCATATTGCAAGG - Intronic
963568975 3:146968147-146968169 TCTGCAACTTCCATTTTCAATGG - Intergenic
964527926 3:157635130-157635152 ATATTAGCTACCATTTTCTAAGG + Intronic
964813103 3:160686744-160686766 ACACCAGCTTCTGTTTACAATGG + Intergenic
966048203 3:175579072-175579094 ATAGCTGCTTCCACTTTCAAAGG + Intronic
967304661 3:188048965-188048987 ACCTCACCTTCCAGGTTCAAGGG - Intergenic
968347128 3:198018248-198018270 ACATGAGCTTCCATATTCATTGG + Intronic
968681326 4:1922542-1922564 ACAGCAGCATCCACTTACAAAGG - Intronic
970495223 4:16618209-16618231 CCAGCAGCTTCCATTTTCACTGG + Intronic
970501719 4:16684085-16684107 AGATCAGTTCCCATTTTCCATGG - Intronic
971131413 4:23814932-23814954 ACCAAAGCTTGCATTTTCAAGGG + Intronic
974009358 4:56592967-56592989 ACAGGGTCTTCCATTTTCAAGGG - Intronic
975395038 4:73864695-73864717 ACCAAAGCTTCCATTTTTAAAGG + Intergenic
975980702 4:80155578-80155600 GCATCAGCTAACATTTTCTATGG - Intergenic
976320238 4:83705982-83706004 ATATCACCTTCCATGTTCAATGG - Intergenic
976756817 4:88507479-88507501 AGTTCAGCTTCCATTTACAGAGG + Intergenic
977134046 4:93279882-93279904 AAATTAGTTTCCATTTTGAAGGG + Intronic
979083136 4:116368727-116368749 ACATTTACTCCCATTTTCAATGG + Intergenic
980440142 4:132831934-132831956 AAATCAGCTTTCAGTTTCCATGG - Intergenic
981056212 4:140364646-140364668 ACATCAGCTGCCAGTCTTAATGG + Intronic
982900042 4:160987617-160987639 TCAATAGCTGCCATTTTCAAAGG - Intergenic
983218978 4:165026523-165026545 ACTTCAGCTTGCTTTTTCAGAGG + Intergenic
983801896 4:171941666-171941688 GAATCAGGTTCCTTTTTCAAAGG - Intronic
983851656 4:172588180-172588202 ACATAAACTTCCTTTTTCAGGGG - Intronic
984856932 4:184203573-184203595 ACCTCTGCTTCCATTGTCACGGG - Intronic
984881092 4:184410501-184410523 ACAGCAGCCTCCTTTCTCAATGG + Intronic
986334476 5:6743184-6743206 CCATCTTGTTCCATTTTCAAGGG + Intronic
987541510 5:19261609-19261631 ACAATATCTTCCATTTTGAACGG + Intergenic
987866745 5:23550495-23550517 ACATAAGCTAACATTTTAAAAGG + Intergenic
987938014 5:24494538-24494560 ATTTGAGTTTCCATTTTCAAAGG - Intronic
989232379 5:39101283-39101305 ACTTCAGCTGCCAGTTTCACTGG - Intergenic
989260152 5:39410193-39410215 TCATCAGCTAACAGTTTCAAAGG + Intronic
989829880 5:45902895-45902917 GCATAAACTTCAATTTTCAAAGG + Intergenic
990957273 5:61355150-61355172 ATATCAGTTTCCCTTGTCAAAGG + Intronic
990988636 5:61663430-61663452 TCATCACCTTTCTTTTTCAAAGG + Intronic
993773968 5:91967940-91967962 ACAGCAGCTTTCAGTCTCAAAGG - Intergenic
993776456 5:92004718-92004740 ATATTAGCTTTCATTTTTAAAGG - Intergenic
994619868 5:102150366-102150388 ACTTCAGCTTCAATTTGCAGAGG + Intergenic
997786287 5:136717023-136717045 CCATCAGCTTTCATTTGCTATGG + Intergenic
998110386 5:139497312-139497334 AGCTCAGCTTCCATTTACACAGG - Intergenic
999873294 5:155774334-155774356 ATTTCTGCTTCCATTTTTAAGGG - Intergenic
1000789232 5:165584676-165584698 ACATTAGCATCCATTTGCAGGGG - Intergenic
1003494725 6:6654004-6654026 ACATCAGCTTCCACTCTGAAAGG - Intronic
1003824503 6:9938142-9938164 TCAGCAGCTTAAATTTTCAAAGG - Intronic
1004583668 6:16978762-16978784 ACATCAGCTTCCATTAATTAAGG - Intergenic
1004661512 6:17714588-17714610 TCATTAGCTTCTATTTCCAAAGG + Intergenic
1004854628 6:19736500-19736522 ACCTCAACAGCCATTTTCAAAGG - Intergenic
1005501444 6:26432090-26432112 ACATCAGCATTCAAGTTCAATGG + Intergenic
1005880882 6:30059962-30059984 ATTTCAAGTTCCATTTTCAAAGG + Intronic
1008103185 6:47414758-47414780 CCATCGGCTTCCATTTTCAGTGG + Intergenic
1008225821 6:48915014-48915036 ACATAAGCAGACATTTTCAATGG - Intergenic
1008325710 6:50178786-50178808 ACATCAGATTCCAAGTTCATTGG - Intergenic
1009366771 6:62862558-62862580 ACATCAGCTTCTCTTTCCCAAGG + Intergenic
1009774433 6:68187308-68187330 ACATTGGCTTCCATATGCAATGG + Intergenic
1010062698 6:71642967-71642989 CAACCAGCTTTCATTTTCAAGGG + Intergenic
1012275645 6:97272098-97272120 ATATAAGCTCCCATTTTCATAGG + Intronic
1014433956 6:121400844-121400866 ACATCTGCTTTCATTAACAAAGG + Intergenic
1014819580 6:125972394-125972416 ACCTCTGTTTCCATTTTCCATGG - Intronic
1015862162 6:137692357-137692379 ACATCAGCTTCCACTCACCAAGG + Intergenic
1018059215 6:160077621-160077643 CCAGCAGTTTTCATTTTCAATGG + Intronic
1020670086 7:11095871-11095893 AGATCAGTCTCCAATTTCAATGG - Intronic
1021669245 7:23018550-23018572 ATATCAGATTCCCTTTTTAAGGG + Intergenic
1021794198 7:24237082-24237104 ACAGCAACTTCCATTTACATGGG + Intergenic
1021925811 7:25532602-25532624 ACAGCAGCTGGCATCTTCAATGG + Intergenic
1022070895 7:26913123-26913145 ACATCAGTTTCCACTCCCAATGG - Intronic
1022289663 7:28988814-28988836 AGATCAGCTTCCATTTTCCAGGG + Intergenic
1022659973 7:32357817-32357839 ACATCAGCTGGCATTTTCCTGGG + Intergenic
1022949898 7:35328132-35328154 ACATCAACACCTATTTTCAAAGG - Intergenic
1023949255 7:44828957-44828979 GCATCCTCTTCCATTTTTAAGGG + Intronic
1024090071 7:45929740-45929762 ACATAAGGTTCCACTTTCCAAGG + Intergenic
1026474864 7:70726472-70726494 ACATCAGATGCCATTTTGATAGG - Intronic
1026478620 7:70759891-70759913 AAATCAGCTTCCTTTTCCAAAGG - Intronic
1028723133 7:94057076-94057098 ACCTCAGCTGCCATTTTAAAAGG - Intergenic
1029984076 7:104905419-104905441 CCATCAGCATGAATTTTCAATGG - Intronic
1030525182 7:110644325-110644347 ACTCAAGCTTCCATTTTCAGGGG - Intergenic
1031316188 7:120260623-120260645 ACCTCTGCCTCCAGTTTCAAGGG + Intergenic
1031383502 7:121117543-121117565 AAATCACCTTCCTTTTCCAAGGG + Intronic
1033946960 7:146730911-146730933 ACATCAGCTTCCATTTTCAAAGG + Intronic
1036517023 8:9453747-9453769 ACATCAGTTTTGTTTTTCAAAGG - Intergenic
1036930111 8:12948089-12948111 ACAACACTTTCCATTTACAATGG - Intronic
1037400683 8:18492473-18492495 TCATGAGCTTCCTTTTGCAAGGG + Intergenic
1037478046 8:19276919-19276941 ACATCACCTGTCTTTTTCAAAGG - Intergenic
1037868552 8:22468702-22468724 AAATCAGAGTCCATTTTAAATGG - Intronic
1040978911 8:53224976-53224998 GCCTCCGCTTCCATTTTCAGTGG - Intergenic
1042935829 8:74057229-74057251 TCATCAGTTCCCATTTTCTAAGG + Intergenic
1043511216 8:80952152-80952174 CCATGATCTTCCATTTTCAATGG + Intergenic
1043997588 8:86837767-86837789 ACATCAGTTTCCATTTCTAATGG + Intergenic
1044780355 8:95737193-95737215 CCATCATCTTATATTTTCAAGGG + Intergenic
1046021867 8:108675034-108675056 ACACCAACTTCCATATTCATTGG - Intronic
1046097762 8:109580688-109580710 GAATCAGATTCCATTTTGAAAGG - Intronic
1048655275 8:136529728-136529750 ACTTCAGATCCTATTTTCAAGGG - Intergenic
1050537619 9:6644616-6644638 ACAGGGTCTTCCATTTTCAAGGG + Exonic
1052077025 9:24155762-24155784 AAAACACCTTCCATTTTAAAAGG + Intergenic
1052244076 9:26312633-26312655 TCGTCAGCTTCCCTTATCAACGG - Intergenic
1052813158 9:33079154-33079176 ACCTCTGCTTTCATTTTGAATGG + Intergenic
1052944517 9:34157144-34157166 AACTCAGCTTCCATTTTTAGAGG - Intergenic
1053283040 9:36833802-36833824 AGATCATCTCCCACTTTCAAAGG + Exonic
1055683124 9:78739391-78739413 AATTCACCTTCCGTTTTCAAGGG + Intergenic
1056489977 9:87096290-87096312 ACACCACCTTGCATTTCCAAGGG - Intergenic
1058818879 9:108710968-108710990 GCAGCAGCCTCGATTTTCAATGG + Intergenic
1060305086 9:122404387-122404409 AGACCAGCTGCCATTTTGAATGG - Intergenic
1060443282 9:123662011-123662033 ACATGAGTTTCCATATTAAATGG + Intronic
1060762948 9:126271406-126271428 ACATCACCTCCCACTTCCAAAGG + Intergenic
1185539529 X:891401-891423 ACATCAGTTTCCCTTGTCTAAGG + Intergenic
1186424764 X:9455228-9455250 ACATCACCTTCCATTGCAAAAGG + Intergenic
1186684603 X:11912268-11912290 GCATGAGCTTCCATTTCCAAGGG - Intergenic
1187187774 X:17003481-17003503 ACATCACCCTCCAACTTCAAAGG - Intronic
1189220910 X:39370935-39370957 AGATGATCTTCTATTTTCAAGGG + Intergenic
1189692942 X:43635886-43635908 ACAGCAACTTCCATTTACAAGGG - Intergenic
1192301563 X:69909382-69909404 ACCTCTGCTTCCAGGTTCAAGGG + Intronic
1193167818 X:78302142-78302164 ATATCATCTCCCCTTTTCAAAGG + Intronic
1194428969 X:93777002-93777024 AGATGAGCTTCTATTTTGAAAGG - Intergenic
1196239435 X:113324710-113324732 CCATCCGCATCCATTTGCAAGGG - Intergenic
1196347616 X:114683402-114683424 ACTTCAGCTTACATTTACTAGGG - Intronic