ID: 1033947564

View in Genome Browser
Species Human (GRCh38)
Location 7:146740750-146740772
Sequence AGCCTGGAACCCACTACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033947558_1033947564 19 Left 1033947558 7:146740708-146740730 CCAGAATCCCTGGACAGCTGTGA 0: 1
1: 0
2: 1
3: 19
4: 197
Right 1033947564 7:146740750-146740772 AGCCTGGAACCCACTACAGCAGG 0: 1
1: 0
2: 1
3: 18
4: 138
1033947560_1033947564 12 Left 1033947560 7:146740715-146740737 CCCTGGACAGCTGTGACTGGCAT 0: 1
1: 0
2: 1
3: 18
4: 175
Right 1033947564 7:146740750-146740772 AGCCTGGAACCCACTACAGCAGG 0: 1
1: 0
2: 1
3: 18
4: 138
1033947561_1033947564 11 Left 1033947561 7:146740716-146740738 CCTGGACAGCTGTGACTGGCATG 0: 1
1: 0
2: 1
3: 24
4: 194
Right 1033947564 7:146740750-146740772 AGCCTGGAACCCACTACAGCAGG 0: 1
1: 0
2: 1
3: 18
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033947564 Original CRISPR AGCCTGGAACCCACTACAGC AGG Intronic
900187103 1:1337675-1337697 AGCCTGGACCCCACCTCATCTGG - Intronic
902464508 1:16607757-16607779 CCCATGGAACCCACTACTGCAGG - Intronic
904318289 1:29680188-29680210 AGCCTGGGACGCACAACTGCTGG - Intergenic
907947336 1:59147480-59147502 AGCCTGGAACCCTTGACAGCTGG + Intergenic
908253703 1:62285316-62285338 AGACTGGAAACCATTCCAGCTGG + Intronic
908260544 1:62336784-62336806 AGCCTGGAGGCCCCTACACCTGG + Intergenic
911822107 1:102435807-102435829 GGCCTGGAACCAGCTAAAGCAGG + Intergenic
912975331 1:114324318-114324340 AGCCAGGTACCCACCACAGTGGG - Intergenic
913646548 1:120861111-120861133 AGAGAGGAACCCACTACAGCTGG - Intergenic
914080101 1:144401761-144401783 AGAGAGGAACCCACTACAGCTGG + Intergenic
914175007 1:145270296-145270318 AGAGAGGAACCCACTACAGCTGG + Intergenic
914529731 1:148511775-148511797 AGAGAGGAACCCACTACAGCTGG + Intergenic
914828936 1:151156701-151156723 AGACTGGCACCCAGCACAGCAGG + Exonic
922061522 1:222097217-222097239 AGCCTTCAGCCCACTACAGCAGG + Intergenic
922668156 1:227490219-227490241 AGCCTGGAACCCTGTACCCCAGG - Intergenic
1065902028 10:30216819-30216841 AGCCTGTATCCCATTACAGATGG - Intergenic
1066657703 10:37711304-37711326 TGCCTGGCACCCAGTCCAGCAGG + Intergenic
1067071743 10:43137840-43137862 CGCCCGGCACCCACCACAGCCGG + Intergenic
1069015746 10:63427270-63427292 ACTCTGGAGCCCACTCCAGCCGG + Intronic
1077817620 11:5701750-5701772 AGCGTGGAACAGATTACAGCAGG + Intronic
1079987652 11:27215713-27215735 AGCTTGGAACCTGCAACAGCAGG + Intergenic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1083717455 11:64585931-64585953 GGCCTGGAAACCAGGACAGCAGG - Intergenic
1089303083 11:117510293-117510315 TGCCTGGAACCCAAAACACCCGG + Intronic
1090354328 11:126129708-126129730 AGCATGGAACCCACTGTAGAGGG + Intergenic
1097074190 12:56380383-56380405 AGCCTTGTACCCCCTGCAGCAGG - Intergenic
1099159487 12:79223466-79223488 AGCCTAGGGCCCACTACAGCAGG + Intronic
1101990125 12:109477456-109477478 AAGCTGGAACCCACTCCGGCCGG - Exonic
1102385269 12:112503819-112503841 AGCCTGGCACCCACAGCTGCTGG + Intronic
1104118361 12:125772597-125772619 AGCCAGAAAACCACAACAGCTGG - Intergenic
1104216812 12:126741792-126741814 AGCCTGGAAACCTCTCCACCAGG - Intergenic
1104971176 12:132531274-132531296 AGCCTGGGACCCACTAGTGGGGG + Intronic
1104982924 12:132582129-132582151 GGCCTGGAACCGACTGCACCGGG + Exonic
1109720031 13:66264170-66264192 AGCCTGGAACTAACTACTCCTGG + Intergenic
1110925505 13:81146231-81146253 GTCCTGAAACCCACTACAGCTGG + Intergenic
1111337540 13:86841574-86841596 GGCCTGTACCCCACTGCAGCTGG + Intergenic
1113568331 13:111334876-111334898 AGCCTGGCAGCCACTGCAGCGGG - Intronic
1114131957 14:19801420-19801442 AGCCTGGTCTCCAGTACAGCGGG - Intronic
1118720043 14:68587436-68587458 AACCAGGAACCCAAGACAGCTGG + Intronic
1119711392 14:76825018-76825040 AGCCTGGATCCAACAGCAGCAGG - Intronic
1120236877 14:81903023-81903045 AGCCTGGAACCCAGTTCCACTGG + Intergenic
1121655171 14:95589698-95589720 AGCCTGAAATCCACTATAGTGGG + Intergenic
1124577570 15:30923317-30923339 AGCCTAGAACCAAATACAGAAGG + Intronic
1128474637 15:67986691-67986713 ATCATGGAACCTACTACAGGGGG - Intergenic
1128892459 15:71343351-71343373 ACCCTGGAAACTAATACAGCGGG - Intronic
1132140651 15:99390833-99390855 AGCCTGGAAGCCACTAGAGGGGG + Intergenic
1132669625 16:1097245-1097267 AGCCTGGAACCGGCTACAGCTGG - Intergenic
1134674944 16:16083687-16083709 AGCCTGGACCCAAGTTCAGCTGG - Intronic
1135655899 16:24249192-24249214 AGCTTGCAGCCCTCTACAGCAGG + Intergenic
1136027919 16:27481825-27481847 AGACTGGAAACCACGGCAGCTGG - Intronic
1141015334 16:80443822-80443844 TGACTTTAACCCACTACAGCAGG - Intergenic
1142300907 16:89257312-89257334 AGCCTGGAACCCACGCCCACCGG - Intergenic
1142795473 17:2303769-2303791 AGCCAGGAAACCACCACAGACGG + Exonic
1143083266 17:4397035-4397057 CGCCTGGAATCCAGTCCAGCAGG - Intergenic
1151916670 17:77123387-77123409 GGCCTGGGACCCACTTCAGGGGG - Intronic
1157067278 18:44366691-44366713 TGGATGGAGCCCACTACAGCTGG - Intergenic
1157581533 18:48776746-48776768 AGGCTGGAACCCACTGCGGGTGG + Intronic
1157836401 18:50907243-50907265 AGCCTGGAAGCCACCAGGGCAGG - Intronic
1159910396 18:74140204-74140226 ATCCAGGAACCCAGAACAGCAGG + Exonic
1160136287 18:76274364-76274386 AGCCCGCAGCCCACTACACCAGG + Intergenic
1160354406 18:78214843-78214865 AGCTTTCAACCCACTTCAGCAGG - Intergenic
1161857774 19:6775567-6775589 AGCCTGGAGCCTGATACAGCTGG - Intronic
1162614222 19:11784287-11784309 AGCCTGGAAGTCACTTCAGATGG + Intergenic
1162796504 19:13090101-13090123 AGCCTGCCCCCCACTACAGAGGG - Intronic
1164816558 19:31208663-31208685 AGCATGGAACCTATCACAGCTGG + Intergenic
1166528155 19:43526246-43526268 AGCCTGGGCCCCACTAAGGCGGG + Exonic
1166631585 19:44411851-44411873 TGCCTGGAACTGACTCCAGCGGG - Intergenic
1166636591 19:44456770-44456792 TGCCTGGAACTGACTCCAGCTGG + Intergenic
1168142618 19:54399330-54399352 AGCCTAGGACCCACCCCAGCAGG + Intergenic
1202648661 1_KI270706v1_random:161793-161815 TGCCTGGAACTGACTCCAGCTGG + Intergenic
935403029 2:102680490-102680512 ATCCTGGAACCTCCTCCAGCAGG - Intronic
937819713 2:126295904-126295926 AACCTGGAACCAACTTCAGTAGG + Intergenic
938541427 2:132286824-132286846 TGCCTGGAACTGACTCCAGCTGG + Intergenic
1169982012 20:11395232-11395254 AGCCATGCACCCACTACATCTGG - Intergenic
1171870323 20:30519846-30519868 TGCCTGGAACTGACTCCAGCTGG + Intergenic
1172339584 20:34145576-34145598 TGCCTGGAAACAACTATAGCTGG - Intergenic
1173158954 20:40638468-40638490 AGAGTGGAACCCAAGACAGCTGG + Intergenic
1176001846 20:62835572-62835594 ACCCTGGAACCCCCTCCAGCTGG - Intronic
1176603192 21:8810895-8810917 TGCCTGGAACTGACTCCAGCTGG - Intergenic
1176612066 21:8992282-8992304 TGCCTGGAACTGACTCCAGCTGG - Intergenic
1178833756 21:36078666-36078688 AGCCTGCAGCCCACAAAAGCTGG + Intronic
1178835714 21:36095854-36095876 ATCATGGAACCCATCACAGCAGG + Intergenic
1179541321 21:42085028-42085050 GGCCTGGGACCCACAGCAGCAGG - Intronic
1180345478 22:11702452-11702474 TGCCTGGAACTGACTCCAGCTGG - Intergenic
1180352241 22:11814860-11814882 TGCCTGGAACTGACTCCAGCTGG + Intergenic
1181463024 22:23096452-23096474 TTCCAGGAACCCACGACAGCAGG - Intronic
949773943 3:7610372-7610394 AGTCTGGAACCAATGACAGCAGG - Intronic
950579376 3:13852570-13852592 GGGCTGGAACCCACAGCAGCTGG + Intronic
953756695 3:45652691-45652713 TGCCTGGCACCCACAAAAGCTGG - Intronic
953914462 3:46909513-46909535 AGCCTGAGACCCAGAACAGCAGG - Intergenic
953920425 3:46947745-46947767 GGCCTGACACCAACTACAGCAGG + Intronic
954580544 3:51700738-51700760 TGCTTGGCACCCACTACAGCTGG + Intronic
958977195 3:100682066-100682088 CGCCTGTACCCCACTGCAGCCGG - Intronic
959838183 3:110944794-110944816 AGCCTGGACTCCAGTAGAGCTGG - Intergenic
960879611 3:122331457-122331479 AGCCTGGACCCCATGACAGGAGG + Intronic
961714303 3:128848198-128848220 AGCCAGGGACCCACTGCTGCTGG + Intergenic
962017182 3:131453856-131453878 AGCCTGGAGCCCCCAAAAGCTGG + Intergenic
962709943 3:138077820-138077842 AGGCTGGAACCCACAGCAGTGGG - Intronic
966684241 3:182676654-182676676 AGCTAGGAGCCCAGTACAGCTGG - Intergenic
967048077 3:185755698-185755720 AGTCTGAAACCCAGTAGAGCAGG - Intronic
967140190 3:186551172-186551194 AGCCTTGTACCCCCTGCAGCAGG - Exonic
970511844 4:16788889-16788911 AGCCAGCAGCCCACTGCAGCAGG + Intronic
973374883 4:49279756-49279778 TGCCTGGAACTGACTCCAGCTGG + Intergenic
973375787 4:49285778-49285800 TGCCTGGAACTGACTCCAGCTGG + Intergenic
973376686 4:49291797-49291819 TGCCTGGAACTGACTCCAGCTGG + Intergenic
973377606 4:49297949-49297971 TGCCTGGAACTGACTCCAGCTGG + Intergenic
973378526 4:49304085-49304107 TGCCTGGAACTGACTCCAGCTGG + Intergenic
973380535 4:49317418-49317440 TGCCTGGAACTGACTCCAGCTGG - Intergenic
973381623 4:49324463-49324485 TGCCTGGAACTGACTCCAGCTGG - Intergenic
973382528 4:49330485-49330507 TGCCTGGAACTGACTCCAGCTGG - Intergenic
973868846 4:55144071-55144093 AGACTGCAACCCCCTACAGGTGG + Intergenic
974670657 4:65025864-65025886 AACCTGGAACCTACTAGAGAAGG - Intergenic
975529340 4:75384989-75385011 AGCCTCAAATCCACTACAGACGG + Intergenic
983192667 4:164771411-164771433 AGCCTTGAACTCACTACCTCCGG - Intergenic
985975782 5:3418196-3418218 AGCCTCTAAGCCACTACGGCTGG + Intergenic
986328577 5:6700963-6700985 AGCCTGGAAGCTACCAGAGCTGG - Intergenic
986873813 5:12081576-12081598 ACGCTGGCACCCACAACAGCTGG + Intergenic
987999298 5:25329901-25329923 TGCCTGTAACCCACTGCAGCTGG - Intergenic
989068967 5:37490547-37490569 ACCCTGCTACCCACAACAGCAGG - Intronic
989977419 5:50602800-50602822 AGAGAGGAACCCACTACAGCTGG - Intergenic
997670808 5:135670409-135670431 TGCCTGGAAAAGACTACAGCAGG - Intergenic
998899277 5:146835397-146835419 AGCATAGAGCCCACTTCAGCAGG + Intronic
999343979 5:150798478-150798500 AGTTTGGAACCCAGTTCAGCTGG + Intergenic
1003113601 6:3268564-3268586 AGACTGGAACCCACTCCAAGTGG - Intronic
1004976252 6:20970202-20970224 AGCCTGGAAGCCACTTGAGGGGG - Intronic
1006005236 6:30996681-30996703 GGCCTGGGACACACCACAGCAGG + Intergenic
1007921243 6:45611557-45611579 AGCCTGGAACTCACCATTGCAGG + Intronic
1014324458 6:119974788-119974810 AGCCTGGAACCCAGAATAGAAGG - Intergenic
1017197353 6:151716306-151716328 AGTCTGGGACCCACTTGAGCAGG + Intronic
1019214570 6:170434965-170434987 AGCTTGGAACCCACCGCAGCGGG + Intergenic
1019657073 7:2201523-2201545 ATCCTGGAACCTACGGCAGCCGG + Intronic
1020849789 7:13337782-13337804 AGCCAGGATCCCCCTACAGCTGG - Intergenic
1021930683 7:25578349-25578371 GGCCTGGAACCCACTTCCTCAGG + Intergenic
1026511273 7:71029209-71029231 AGTGTTGAACCCACTTCAGCTGG + Intergenic
1029524510 7:101086868-101086890 ACCCTGGCACCCTATACAGCAGG + Intronic
1033947564 7:146740750-146740772 AGCCTGGAACCCACTACAGCAGG + Intronic
1037549625 8:19957541-19957563 AGCCTTGAACCCACTGGTGCAGG - Intronic
1038658500 8:29475919-29475941 CACCTGGAAGCCACTACAGTGGG + Intergenic
1039487717 8:37924722-37924744 AGCCTGGCAGCCACTAGAGGGGG - Intergenic
1052749836 9:32478489-32478511 AGCCTGGAATTCACTACAGTGGG + Intronic
1053010523 9:34630330-34630352 AGCCTGGACCCCACTCCTCCCGG + Intergenic
1055469910 9:76601082-76601104 AGGCTGGAGCCCACTGCAGTTGG + Intergenic
1059277672 9:113109421-113109443 AGCCCAGGACCCACCACAGCAGG - Intergenic
1059278579 9:113115130-113115152 AGCCCAGGACCCACCACAGCAGG + Intergenic
1060896819 9:127224172-127224194 AGACTCGAACCCACCACAACTGG + Intergenic
1062064159 9:134517446-134517468 AGCCTGGCTCCCCCTAAAGCTGG + Intergenic
1203698595 Un_GL000214v1:117861-117883 TGCCTGGAACTGACTCCAGCTGG + Intergenic
1203699514 Un_GL000214v1:124012-124034 TGCCTGGAACTGACTCCAGCTGG + Intergenic
1203700460 Un_GL000214v1:130295-130317 TGCCTGGAACTGACTCCAGCTGG + Intergenic
1203701375 Un_GL000214v1:136315-136337 TGCCTGGAACTGACTCCAGCTGG + Intergenic
1203480207 Un_GL000224v1:4898-4920 TGCCTGGAACTGACTCCAGCTGG + Intergenic
1203481174 Un_GL000224v1:11226-11248 TGCCTGGAACTGACTCCAGCTGG + Intergenic
1203482138 Un_GL000224v1:17535-17557 TGCCTGGAACTGACTCCAGCTGG + Intergenic
1203548701 Un_KI270743v1:151255-151277 TGCCTGGAACTGACTCCAGCTGG + Intergenic
1203549716 Un_KI270743v1:157150-157172 TGCCTGGAACTGACTCCAGCTGG - Intergenic
1203550659 Un_KI270743v1:163315-163337 TGCCTGGAACTGACTCCAGCTGG - Intergenic
1203569805 Un_KI270744v1:120249-120271 TGCCTGGAACTGACTCCAGCTGG + Intergenic
1193340018 X:80336409-80336431 AGCCTGGAAACCACTTCAGTAGG + Intronic