ID: 1033956256

View in Genome Browser
Species Human (GRCh38)
Location 7:146852099-146852121
Sequence ATGGTAACATTCTGAGACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033956254_1033956256 -10 Left 1033956254 7:146852086-146852108 CCTGTTTCCAAATATGGTAACAT 0: 1
1: 9
2: 191
3: 1097
4: 2812
Right 1033956256 7:146852099-146852121 ATGGTAACATTCTGAGACATTGG No data
1033956253_1033956256 -9 Left 1033956253 7:146852085-146852107 CCCTGTTTCCAAATATGGTAACA 0: 1
1: 7
2: 171
3: 1025
4: 2648
Right 1033956256 7:146852099-146852121 ATGGTAACATTCTGAGACATTGG No data
1033956251_1033956256 17 Left 1033956251 7:146852059-146852081 CCTCATATTAACTATACATGTAA 0: 1
1: 0
2: 2
3: 25
4: 271
Right 1033956256 7:146852099-146852121 ATGGTAACATTCTGAGACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033956256 Original CRISPR ATGGTAACATTCTGAGACAT TGG Intronic
No off target data available for this crispr