ID: 1033960966

View in Genome Browser
Species Human (GRCh38)
Location 7:146912593-146912615
Sequence GGGATATTACAAATAAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 333}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033960966 Original CRISPR GGGATATTACAAATAAAACA TGG (reversed) Intronic
902281043 1:15374712-15374734 GGGATGATGCAGATAAAACATGG - Intronic
903199964 1:21728064-21728086 GGGATATTTCTAAGAAATCAGGG + Intronic
904570326 1:31459464-31459486 GGAATATTTCTAGTAAAACAGGG + Intergenic
908995793 1:70152140-70152162 GCAAAATTACAAATAAGACATGG - Intronic
909073634 1:71026795-71026817 GGGATATTAATAATAAAAGATGG - Intronic
909074014 1:71031380-71031402 GGGATATTAATAATAAAAGGTGG - Intronic
909245472 1:73276449-73276471 GAGAAATCACAAATAAAACCAGG - Intergenic
910526677 1:88186667-88186689 GGGAGATTACACATATAACTGGG + Intergenic
910606229 1:89087739-89087761 AAGATAATAAAAATAAAACATGG - Intergenic
911703509 1:100983854-100983876 GTAAAATTACAAATAAAATAAGG + Intergenic
912541487 1:110419669-110419691 TGGATAGTAAATATAAAACATGG - Intergenic
913372438 1:118115840-118115862 AGGATATTATAAATTAAACAGGG + Intronic
913384537 1:118244902-118244924 GGAAAAATACAAAAAAAACAAGG - Intergenic
913387584 1:118276636-118276658 GGGATATAACACCTAAAAGATGG + Intergenic
913645950 1:120853896-120853918 CCGATATTAAAAAGAAAACAAGG - Intergenic
914080689 1:144408987-144409009 CCGATATTAAAAAGAAAACAAGG + Intergenic
914175600 1:145277521-145277543 CCGATATTAAAAAGAAAACAAGG + Intergenic
914530321 1:148518990-148519012 CCGATATTAAAAAGAAAACAAGG + Intergenic
915405364 1:155656129-155656151 GGGATATTATAGTTAAAATAGGG - Intergenic
916190762 1:162175831-162175853 GGGATATTACAGATAAGCAAGGG - Intronic
916394185 1:164367592-164367614 GAGAAATTAAAAATAAAATAGGG + Intergenic
916480060 1:165206825-165206847 GGGAGAGAAGAAATAAAACAGGG - Intronic
919183910 1:194119655-194119677 GGGATATAACAGATAAATAAAGG - Intergenic
919235325 1:194833840-194833862 TTGATATGACAAATAAAAAAAGG + Intergenic
919377418 1:196811437-196811459 TGGATATTACAAATCACACACGG - Intergenic
919588256 1:199466028-199466050 AGCATAATACAAATAAAGCATGG + Intergenic
921563231 1:216683858-216683880 GGGATTTTACTACTAAAACCAGG - Intronic
921775485 1:219095139-219095161 GGTATATCACAAACATAACAGGG + Intergenic
921786421 1:219236075-219236097 TGGACATTAAAAATAAAAAAAGG + Intergenic
923459297 1:234194811-234194833 GGAATATTCCAATTCAAACATGG + Intronic
1064790441 10:18951857-18951879 GGTATATTACAGATAAAAGCAGG + Intergenic
1066466357 10:35653767-35653789 GGGTTATAAGAAATAAAAAAGGG + Intergenic
1066748213 10:38624164-38624186 GGAACATTTCAATTAAAACAAGG + Intergenic
1066968521 10:42293922-42293944 GGAACATTTCAAATAAAACAAGG - Intergenic
1071388660 10:85147741-85147763 GGAATATTATAAATGAAACAAGG - Intergenic
1071474777 10:86016772-86016794 GGAATAATACACATAAAAGAGGG - Intronic
1071559499 10:86633894-86633916 GGGAAATTCCAAAAAATACACGG + Intergenic
1071750207 10:88466907-88466929 GGGGTTTTAAAAATAAAAGAAGG - Intronic
1072344652 10:94491794-94491816 GGGGCATTACTAATAAAATAAGG - Intronic
1072759346 10:98042947-98042969 TAGATATTACAAATATAAGATGG + Intergenic
1073278849 10:102336794-102336816 AGGATATTACAGCTAAAATAGGG - Intronic
1073332311 10:102678447-102678469 AAGATTTTACAAATAAAAGAGGG + Intronic
1074269056 10:111934927-111934949 ATGATGTAACAAATAAAACAGGG - Intergenic
1075363150 10:121858345-121858367 GGGTTATTATAAAAAAAAAATGG - Intronic
1079962985 11:26946792-26946814 AGGATATTACAAATGAAATAAGG + Intergenic
1080308049 11:30858088-30858110 GGGAGAAAACAAATGAAACAGGG - Intronic
1081147908 11:39586075-39586097 GGGAAATTAAAAAAAAAAGACGG + Intergenic
1081228068 11:40550006-40550028 ATGATATTAGATATAAAACATGG - Intronic
1084976912 11:72805899-72805921 GTAATAATAAAAATAAAACAAGG - Intergenic
1088263616 11:107969155-107969177 ATGATACTAAAAATAAAACAGGG - Intergenic
1092644073 12:10550665-10550687 AGGATTTTTCAAATCAAACAAGG + Intergenic
1094125416 12:27017824-27017846 TGCATACTACAAAGAAAACAAGG - Intergenic
1094289298 12:28828523-28828545 GGGATATACCAAATAAAGCATGG + Intergenic
1095935235 12:47672893-47672915 GGGATATTACACATATCACGTGG + Intronic
1096766127 12:53891561-53891583 TGAATATTACAAATGAAAAATGG + Intergenic
1098690437 12:73481140-73481162 GTGATATTTGAAATAAAACTTGG - Intergenic
1099437902 12:82665728-82665750 TGGAGCTTACAAATATAACATGG + Intergenic
1099638904 12:85257929-85257951 GGTATGTTAAAAATAAAACCTGG + Intronic
1100180380 12:92079075-92079097 GGCATATTAGAAATAAAAACTGG - Intronic
1101477584 12:105065190-105065212 GAGATATTACAGATAAATCTGGG - Intronic
1102850252 12:116236365-116236387 GAGATATCACAGATAAAAAATGG + Intronic
1104130522 12:125889361-125889383 GTGATACTTCAAATAAAAAAGGG - Intergenic
1104276896 12:127337261-127337283 GGGATATCAGAAATAAGAGATGG + Intergenic
1104363179 12:128153106-128153128 GGTAATTTACAAATAAAAGAGGG + Intergenic
1105576316 13:21656187-21656209 TGCATACTACATATAAAACATGG - Intergenic
1106762747 13:32883029-32883051 GGAATATAATAAAGAAAACATGG - Intergenic
1107608596 13:42089024-42089046 GGGATATTACATATGACAAAGGG + Intronic
1107668404 13:42716803-42716825 TGAATATTAGCAATAAAACATGG + Intergenic
1108280976 13:48861462-48861484 AGGCTATTAGAAATAAAATACGG + Intergenic
1109073272 13:57798293-57798315 GGCATATCAGAAATAAAAGATGG - Intergenic
1109151617 13:58855715-58855737 GAGATATTTTAAATAAAACTTGG + Intergenic
1109447480 13:62461295-62461317 GGAAAATTACAAATGAACCAAGG + Intergenic
1109796355 13:67318349-67318371 TGGAGATTACAAAGCAAACAGGG + Intergenic
1109883828 13:68516374-68516396 TGAATATTACCTATAAAACATGG - Intergenic
1110591687 13:77269911-77269933 GTGATATTACTGATTAAACAAGG + Intronic
1111096366 13:83520905-83520927 ATGATATTTCAAATAAAACATGG + Intergenic
1111203202 13:84966816-84966838 AGGGTACTTCAAATAAAACATGG + Intergenic
1111578056 13:90184386-90184408 GGTATACTTCAATTAAAACAAGG - Intergenic
1111735614 13:92135374-92135396 GAAATATTACAATTGAAACAGGG - Intronic
1111821954 13:93226312-93226334 GAGATATTTGAAATAAAAAAAGG + Intergenic
1112686945 13:101840282-101840304 GGGAAATAACAAATATAAAATGG - Intronic
1112725344 13:102297588-102297610 GGTTTATTACAAATAAAAAAGGG + Intronic
1115065983 14:29260037-29260059 GGGAATTTACAAATAAATGAAGG - Intergenic
1115374430 14:32658005-32658027 TGGATCTTAAACATAAAACAAGG + Intronic
1116427877 14:44812029-44812051 GAAATATTGCTAATAAAACAAGG - Intergenic
1118706176 14:68482587-68482609 ATGATATTGAAAATAAAACATGG - Intronic
1119311660 14:73651955-73651977 GAGATTTTAAAAATAAAATATGG - Intronic
1119901928 14:78268217-78268239 GGGATATTAAAAAACAAACTTGG + Intronic
1120256053 14:82120997-82121019 AGGAAAATAAAAATAAAACAGGG - Intergenic
1120386040 14:83847088-83847110 GGGATAATACAAATACAAGTGGG + Intergenic
1120549697 14:85855013-85855035 GGGCTACTATAAATAAAAGAAGG + Intergenic
1122311838 14:100802311-100802333 GAGCTATTACAAATAAAGCCGGG - Intergenic
1124593385 15:31073048-31073070 GAGATATTACACCAAAAACATGG - Intronic
1125278661 15:38021137-38021159 GGGACATTACTATTAAAATAAGG + Intergenic
1127168566 15:56274289-56274311 GAAATACTAGAAATAAAACATGG - Intronic
1127178894 15:56393214-56393236 GGGAAATGACAAATTAAAAAGGG - Intronic
1130196915 15:81788354-81788376 GTGATATTAAAAGTAAAATAGGG + Intergenic
1130227082 15:82067362-82067384 GGGATTCAACAAATAAAACTTGG + Intergenic
1131910763 15:97198038-97198060 GTAATAATCCAAATAAAACATGG - Intergenic
1133700100 16:8300711-8300733 GGTATATTAAAAAAAAAAAAAGG - Intergenic
1134270559 16:12729283-12729305 GGGATATTATTAATATTACAAGG + Intronic
1134827608 16:17297198-17297220 GTGGTGTTACTAATAAAACATGG - Intronic
1136734549 16:32453134-32453156 GGAACATTTCAATTAAAACAAGG - Intergenic
1137328170 16:47461867-47461889 GGGATATAAGACATAAAGCAAGG - Intronic
1138348530 16:56334347-56334369 GGGAAATTACACATGAAACATGG + Intronic
1138858582 16:60726563-60726585 AGGATATTAAAATGAAAACAAGG - Intergenic
1139060894 16:63250288-63250310 GGGGAATTACAAATAAACTATGG + Intergenic
1203018530 16_KI270728v1_random:376468-376490 GGAACATTTCAATTAAAACAAGG + Intergenic
1203036865 16_KI270728v1_random:649626-649648 GGAACATTTCAATTAAAACAAGG + Intergenic
1143968622 17:10775625-10775647 GGGACATGACAAATAAAATATGG + Intergenic
1144065860 17:11623467-11623489 GGGAGATTAAAAATAAAAGAGGG - Intronic
1144792020 17:17865707-17865729 GGAATGTTCCATATAAAACATGG + Intronic
1145220720 17:21086154-21086176 AGGATAGTAAAAATAAAAGAAGG + Intergenic
1146503351 17:33383340-33383362 GGGATATTTCCAAGAAGACAAGG - Intronic
1147553837 17:41463881-41463903 GGGATGTTTCAAATCAGACATGG - Intronic
1149285954 17:55164786-55164808 GGAAGATAACAAACAAAACAAGG - Intergenic
1149485691 17:57041202-57041224 GGGATTTTACAAAGAAAAAGAGG + Intergenic
1150181475 17:63125705-63125727 GGGTTCTTTTAAATAAAACAAGG - Intronic
1151947367 17:77327006-77327028 AGGATATTACAAAGGATACAGGG - Intronic
1152324353 17:79627027-79627049 GGCATGTTACTAATAAAATAAGG + Intergenic
1153060985 18:994946-994968 GTGACATTAGAAATAAAAGAGGG + Intergenic
1153412742 18:4811833-4811855 GGGATATTAAGATTAAAACATGG + Intergenic
1154242236 18:12663253-12663275 GGGAAATTAAAAACAAAATAAGG + Intronic
1154515054 18:15154217-15154239 GTTATATTTCAACTAAAACAAGG + Intergenic
1155094482 18:22542839-22542861 TGGATATGACAAAGAAAACAAGG + Intergenic
1155121784 18:22828263-22828285 GTGAGATAAGAAATAAAACAGGG - Intronic
1155937994 18:31774278-31774300 GGGATATTACTAATAATTCGTGG - Intergenic
1155950594 18:31907788-31907810 GGGCTATAAATAATAAAACAAGG - Intronic
1156055045 18:32992358-32992380 GGAATATTAAATTTAAAACAAGG + Intronic
1156128885 18:33943481-33943503 TGGATTTTGCAAATAAAACAAGG + Intronic
1156899142 18:42280340-42280362 GGGGTAATAAAAACAAAACAGGG + Intergenic
1156963149 18:43057352-43057374 GAGTTATTGCAAATAAGACAAGG + Intronic
1157187863 18:45555813-45555835 GAAAAATTACAAAGAAAACAGGG + Intronic
1158376191 18:56871290-56871312 ACTTTATTACAAATAAAACAAGG + Intronic
1159397286 18:67876866-67876888 AGCCTATTAGAAATAAAACAAGG - Intergenic
1159474693 18:68905730-68905752 GGGATATTTCATATAAATAATGG + Intronic
1159896808 18:74004963-74004985 GGGATAATCAAAATAAGACAAGG - Intergenic
1160369025 18:78355871-78355893 GGGTTATTACCAATAAAGCTGGG - Intergenic
1162986513 19:14273827-14273849 GGGATATTAAAAATAAAGAATGG - Intergenic
1163192800 19:15691040-15691062 GGGATGGGCCAAATAAAACATGG - Intronic
1163200483 19:15764235-15764257 GAGACATTACAGATAAGACAAGG - Intergenic
1163228866 19:15985069-15985091 GAGATATTACAGATAAGACAAGG - Intergenic
1164037014 19:21464294-21464316 GGGATTTTAAAAGAAAAACAGGG + Intronic
1164162502 19:22636935-22636957 GGTTTACTAAAAATAAAACATGG - Intronic
1166912532 19:46170095-46170117 GAGATATGAAAAATAAAATAGGG + Intergenic
1167836103 19:52071561-52071583 GGGATATCAAAAACACAACATGG + Intronic
1167841035 19:52120173-52120195 GGGATATCAAAAACATAACATGG + Intronic
1168700798 19:58438373-58438395 GGGACATCTCAAATACAACATGG + Intronic
927363952 2:22272500-22272522 TGGATATTTCAAACAAGACAAGG + Intergenic
928448249 2:31352292-31352314 GAGATATTACAACTTAAAGAAGG - Intronic
928839616 2:35588955-35588977 GAGATATTATAAGTAAAAGAAGG + Intergenic
929166802 2:38890697-38890719 GGGCTATTAAAAATATAAAAGGG - Intronic
929542175 2:42830923-42830945 GAGACATAACACATAAAACATGG + Intergenic
930837040 2:55805320-55805342 GGGAAATTATACATAAAAGAAGG + Intergenic
932035777 2:68245519-68245541 AGCACATTACAAATAAAACCAGG - Intronic
933429891 2:82162537-82162559 AGCATATTACAAATAACATATGG + Intergenic
934311181 2:91866316-91866338 GGAACATTTCAAATAAAACAAGG + Intergenic
935513417 2:104004096-104004118 GAGAAATGACAAATAAGACATGG + Intergenic
935527743 2:104192068-104192090 GGTATATAATAAATAAAACCGGG - Intergenic
936654701 2:114471494-114471516 GGGTAATTAAAAATAAAATAGGG - Intronic
936805834 2:116331541-116331563 AAGTTATTACAAATAAACCAAGG + Intergenic
936977621 2:118235317-118235339 GGTAATTTACAAATAAAAGAGGG - Intergenic
937106963 2:119324915-119324937 GCGCTATTACAAATAAAGCTGGG + Intronic
937825049 2:126359783-126359805 GGGATATTAGAAGTAAACCCTGG + Intergenic
938333479 2:130466635-130466657 TGCATATTAAAAATAAAACTGGG + Intronic
938356334 2:130654036-130654058 TGCATATTAAAAATAAAACTGGG - Intronic
938515315 2:131998999-131999021 GTTATATTTCAACTAAAACAAGG + Intergenic
940457687 2:153921914-153921936 AGGATATTAGAAATATAATAAGG + Intronic
941405937 2:165088365-165088387 AAGCTATTACAAATATAACATGG - Exonic
942060560 2:172225164-172225186 GGGATGTTCCAGATAACACAGGG - Intergenic
942848202 2:180451721-180451743 GTGATATTACAAATCAAAGAAGG + Intergenic
943192164 2:184692560-184692582 AGGATATTACACATAAATCCTGG - Intronic
943536797 2:189162180-189162202 GGAATGAGACAAATAAAACAAGG - Intronic
943625399 2:190193154-190193176 GGGATTTTAAAAATAAAAAATGG + Intronic
943792408 2:191948345-191948367 AGGGAAATACAAATAAAACATGG - Intergenic
944414405 2:199468309-199468331 GGGACATTAAAAAAAAAAAAAGG - Intronic
945731620 2:213544311-213544333 AGTCTATTACAAATAAAAGAAGG - Intronic
1170556430 20:17518695-17518717 GGTATTTTACAAATGAACCAGGG - Intronic
1170872800 20:20222763-20222785 GCAATATTACAAATAAATAAAGG - Intronic
1172049116 20:32102881-32102903 GAGTTCTTACAAATAAAAGAGGG - Intergenic
1172858639 20:38029232-38029254 GGGAAATTAGAAAAAAAATAGGG + Intronic
1173013284 20:39201634-39201656 GGGGTATTTCAAGTACAACATGG - Intergenic
1173888834 20:46486854-46486876 GGGAAATGAGAATTAAAACAAGG - Intergenic
1174373005 20:50106293-50106315 AGGATATTACAAAGAAAATATGG + Intronic
1174845075 20:53936179-53936201 CGGAGATTAGAAATAGAACATGG - Intergenic
1176291991 21:5050834-5050856 TGGATTTTGCAAATAAACCATGG - Intergenic
1177266008 21:18784912-18784934 GGGCTATTCCCAATAATACAAGG + Intergenic
1177976101 21:27852940-27852962 GTTATATTTCAACTAAAACAAGG - Intergenic
1179865266 21:44212811-44212833 TGGATTTTGCAAATAAACCATGG + Intergenic
1180537941 22:16412231-16412253 GGAACATTTCAATTAAAACAAGG + Intergenic
1181535853 22:23544119-23544141 AAGATAATAAAAATAAAACATGG + Intergenic
1182382501 22:29903861-29903883 GGGATATTACACTTGAAATATGG + Intronic
1184618042 22:45651448-45651470 GGGATCTTATAAAAAAAAGAAGG + Intergenic
949255379 3:2039003-2039025 GGGTTATTACTGATAAAACCTGG - Intergenic
949716045 3:6932567-6932589 GGGATATTTAAAATAAAAGGTGG + Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
952244291 3:31568859-31568881 GGGCTTTTACAAATAAAAAGGGG - Intronic
952643632 3:35628982-35629004 GGTATATAACATATAAAATATGG + Intergenic
952643633 3:35629003-35629025 GGTATATAACATATAAAATATGG + Intergenic
953286511 3:41615801-41615823 GGAATTTTAGCAATAAAACATGG - Intronic
953834761 3:46332882-46332904 AGGTTATTACACATAAACCATGG + Intergenic
954271557 3:49513768-49513790 GGGATATTACAAAGATGACAAGG - Intronic
954773029 3:52990790-52990812 CAGATATTACGCATAAAACAAGG + Intronic
955005895 3:54968423-54968445 GACAAATTATAAATAAAACAAGG - Intronic
955096556 3:55804512-55804534 GAAATAATGCAAATAAAACAGGG - Intronic
956045112 3:65187914-65187936 TGGACATTAAAAACAAAACAAGG + Intergenic
956508361 3:69967474-69967496 GGGTTTTTAAAAATAAAGCAAGG + Exonic
956802338 3:72771366-72771388 GGGATATGCCAAATCTAACAAGG + Intronic
956924146 3:73964472-73964494 ACAATATTACAAATAAGACAAGG + Intergenic
957270113 3:78019181-78019203 AGCATATTATAAATAATACATGG - Intergenic
957932020 3:86892468-86892490 GAGATACTACAAATTAAAAACGG - Intergenic
959854917 3:111141205-111141227 GGGCTATTACAAATGAAGAATGG + Intronic
960204710 3:114882443-114882465 TGGATATTAAAATAAAAACAAGG + Intronic
960636425 3:119789320-119789342 GGTAAATTACAAAGAAAAAAAGG + Intronic
960695505 3:120392332-120392354 TGAATATAAAAAATAAAACAAGG + Exonic
960865698 3:122197494-122197516 GGGAAATTATAAATATAAAATGG - Intronic
963513050 3:146273404-146273426 AGAATATCACAAATATAACAAGG + Intergenic
963909361 3:150802214-150802236 GGGATATTATAAAAAACACTGGG + Intergenic
964699282 3:159546203-159546225 GAGACAATAAAAATAAAACAAGG - Intronic
965400221 3:168204847-168204869 AGGATATTACAAATAATATCAGG + Intergenic
965535504 3:169819788-169819810 GTGATAATACAAATAAAAATAGG - Intergenic
965859853 3:173135642-173135664 AGAATCTCACAAATAAAACATGG + Intronic
965947308 3:174259120-174259142 AAGATATTAGAAATAAAATATGG + Intronic
968249399 3:197192875-197192897 GTGATATTATGAATAAAAAAGGG + Intronic
968638060 4:1692811-1692833 GGGATATTGCAAAAATAAAAAGG - Exonic
969380379 4:6792207-6792229 GGCATATTAAAAAAAGAACATGG - Intronic
969825696 4:9756612-9756634 TGGATATTACGAATATGACAAGG + Intergenic
970964608 4:21913896-21913918 GGGATAGTCCAAATAATATAAGG + Intronic
971881604 4:32382149-32382171 GGGCTGTTAGAAATTAAACAGGG - Intergenic
973316965 4:48771220-48771242 GGAATATTACATACAAGACATGG + Intronic
973712328 4:53642288-53642310 GGGATATTAAAAATGAAAGAAGG + Intronic
973884207 4:55304383-55304405 AGTATATTGCAAATAAAAGAGGG + Intergenic
974551193 4:63377338-63377360 GAGATATTAAAAAAAAGACAAGG + Intergenic
974705090 4:65504289-65504311 GTTATTTTAAAAATAAAACAGGG - Intronic
974823641 4:67099347-67099369 GTGATTTTCTAAATAAAACAAGG - Intergenic
975120298 4:70720976-70720998 AGGATTTTAAAAATATAACATGG + Intronic
977140742 4:93368605-93368627 TGGATATTTCAAAAATAACATGG - Intronic
977150411 4:93504509-93504531 GGACCTTTACAAATAAAACAAGG + Intronic
977518334 4:98050311-98050333 AGGAAAGTAGAAATAAAACATGG + Intronic
977805277 4:101290399-101290421 GTGTTGTTAAAAATAAAACATGG - Intronic
978014073 4:103722295-103722317 GGGATATGACAAGGAAAAAAAGG + Intergenic
978135046 4:105247515-105247537 GGGCTATTATAAATAAAAAGAGG - Intronic
978473607 4:109099562-109099584 TGAATATTAGACATAAAACAAGG + Intronic
979720740 4:123897256-123897278 TGGAGATTACAAATAAAAGATGG + Intergenic
980129015 4:128801485-128801507 GTGAGAGTTCAAATAAAACAAGG + Intergenic
981336184 4:143570971-143570993 AGGATAATAAGAATAAAACAAGG + Intergenic
982207496 4:153007737-153007759 GGCATCTCCCAAATAAAACATGG - Intergenic
982920635 4:161269252-161269274 GGTATATAATAAAGAAAACATGG + Intergenic
983065185 4:163201625-163201647 GGCAAGTTACAAATAAAATAAGG + Intergenic
984387907 4:179087431-179087453 TGGCTATTACAAATAAAAATTGG + Intergenic
985228850 4:187793214-187793236 GGGATATTACCAACAAAGCGTGG - Intergenic
985481273 5:112331-112353 AGGAAATTGAAAATAAAACAGGG - Intergenic
987627632 5:20423085-20423107 GTGATATTCCAAATGAAAAACGG + Intronic
988205831 5:28132687-28132709 GGGGTATTAAACATTAAACATGG + Intergenic
989743222 5:44796150-44796172 GGCTTATTAAAAAAAAAACATGG + Intergenic
990194528 5:53299384-53299406 GGGAGGTTAAAAATAAAAGAAGG + Intergenic
991218113 5:64179952-64179974 GGAAAATGAAAAATAAAACAAGG - Intronic
991335397 5:65541121-65541143 GAGATATTACAAAGGATACATGG - Intronic
991932234 5:71765329-71765351 GAGAGATTACAGATTAAACATGG + Intergenic
994064335 5:95519265-95519287 GAGATCTTATAAATAACACATGG + Intronic
994822532 5:104672032-104672054 ATCATATAACAAATAAAACAGGG - Intergenic
994823921 5:104688274-104688296 GCTTTATTCCAAATAAAACAAGG + Intergenic
994918766 5:106014411-106014433 GGGATATTAGATATACCACAAGG - Intergenic
996157899 5:120126058-120126080 AGGATTTTACACATTAAACAGGG - Intergenic
997502019 5:134382793-134382815 GGGATGTTATATATAAAATAAGG + Intronic
997681402 5:135754956-135754978 TGGATATTATAAATAGAAGAGGG - Intergenic
997683397 5:135771861-135771883 TGGATATTACTAATATCACAGGG - Intergenic
998055444 5:139072522-139072544 GGTATATGACAAATATACCAAGG - Intronic
998296895 5:140979404-140979426 GTGAGATTAAAAAAAAAACAAGG - Intronic
998824324 5:146085373-146085395 GTGATTTTCCAAATAAAAGAAGG - Intronic
999528347 5:152433539-152433561 GGGAGATTACCAAAAAAATAAGG + Intergenic
999708487 5:154295253-154295275 ATGAGATTACAACTAAAACAAGG + Intronic
1000368918 5:160516524-160516546 GGGATATTTAAACTAAGACATGG - Intergenic
1000452247 5:161403984-161404006 TGAATATTAAAAATAACACAAGG - Intronic
1000670443 5:164055936-164055958 TGGATATTCAAGATAAAACATGG + Intergenic
1000673981 5:164097902-164097924 GAGATATTACAAATGATAGACGG - Intergenic
1001947258 5:175790150-175790172 GTGTTATCAAAAATAAAACAAGG + Intergenic
1002781112 6:367070-367092 GGGATTTGACAAATAAATGATGG + Intergenic
1003702536 6:8484818-8484840 CGGAGAGTACAAATAATACAAGG - Intergenic
1003955428 6:11161059-11161081 GGGATAATAGAAACAAAACATGG - Intergenic
1003960234 6:11202243-11202265 GAGATAATATAAATAAATCAGGG - Intronic
1004147935 6:13087625-13087647 AGGAAATTACAAATAAAAGCAGG + Intronic
1008031983 6:46707050-46707072 GAGATATTACAAAGCAAAGATGG - Intronic
1008868331 6:56242064-56242086 GGAATATTAAAGATAAAACAGGG - Intronic
1009406617 6:63321557-63321579 AGGATATTATAAAAAAATCATGG - Intergenic
1009632545 6:66216941-66216963 GGAATATTGCCAGTAAAACATGG - Intergenic
1009966192 6:70581477-70581499 TGGATTGTTCAAATAAAACAAGG - Intronic
1010280372 6:74016375-74016397 TGGCTATTATAAATAAAACCAGG - Intergenic
1011769109 6:90655663-90655685 GACAAATGACAAATAAAACAAGG + Intergenic
1012744861 6:103073236-103073258 GGGACTATACAAATATAACAGGG + Intergenic
1013734517 6:113209791-113209813 GGTATTTTGAAAATAAAACATGG + Intergenic
1017072232 6:150585863-150585885 ATGATATAAAAAATAAAACATGG - Intergenic
1017287871 6:152698666-152698688 AGAGTATAACAAATAAAACATGG + Intronic
1017556552 6:155577628-155577650 TGGATATTACAAATTAAAACTGG + Intergenic
1019062937 6:169269788-169269810 GGGACAGCACAGATAAAACAGGG - Intergenic
1020543135 7:9487781-9487803 AGGATATTGAAAATAAACCACGG + Intergenic
1021060791 7:16108373-16108395 AGGATATTATAAATAATAAAGGG + Intronic
1022278427 7:28880412-28880434 GTGAGATTGCAAATGAAACAAGG - Intergenic
1022449743 7:30504096-30504118 GCATTATTACAAATAAGACATGG + Intronic
1023379049 7:39587554-39587576 GGTAAATTCCAAATACAACATGG - Intronic
1023955021 7:44878328-44878350 TGGATATTAGATATAACACAAGG + Exonic
1028875073 7:95812849-95812871 GACCTATTAAAAATAAAACAAGG - Intronic
1029246251 7:99204077-99204099 GGGAAATCAAAATTAAAACAAGG + Intronic
1030171186 7:106604366-106604388 AGGATATCACATATAAAATATGG + Intergenic
1030825566 7:114153145-114153167 GGCATATTAGAAATAAAACTGGG + Intronic
1031188709 7:118518368-118518390 TGGATCTTACAAATAAAAAAAGG - Intergenic
1031214044 7:118868049-118868071 GGGATATGACAAATGACAAATGG - Intergenic
1031809916 7:126353625-126353647 GGGATAATATTAATACAACAAGG - Intergenic
1032000044 7:128259363-128259385 GGGATTTAGCAAATCAAACAAGG + Intergenic
1033960966 7:146912593-146912615 GGGATATTACAAATAAAACATGG - Intronic
1033968016 7:147001932-147001954 TGGAAATTAAAAATAAGACATGG + Intronic
1035130933 7:156652414-156652436 GGCATTTTAGAAAGAAAACATGG - Intronic
1035429506 7:158808040-158808062 GGGGTATTTCTAATAAAAAAAGG - Intronic
1036045750 8:5138004-5138026 GGGATTTTTCAAAGAAAACTTGG - Intergenic
1036197222 8:6730064-6730086 GGGAAATTATAAACAAAAAATGG - Intronic
1036903006 8:12685946-12685968 AGGATATTACAAATAATATCAGG - Intergenic
1037205224 8:16309233-16309255 GGAACATTACAAACAAAAAAAGG - Intronic
1038095563 8:24305862-24305884 GAGATATTAAAAAGTAAACATGG - Intronic
1039247634 8:35627131-35627153 GGGATTTTAAACTTAAAACAGGG + Intronic
1040891009 8:52315802-52315824 GGTATATAACCAAGAAAACATGG - Intronic
1040901963 8:52426946-52426968 AGGATATGACAAAGAGAACAAGG + Intronic
1041053301 8:53957844-53957866 GGGATATTTAAAAAACAACAAGG + Intronic
1041575837 8:59394424-59394446 GGCATATTACAGAGAACACATGG + Intergenic
1041592723 8:59608141-59608163 TGGATATGACAAAAAAAAGATGG + Intergenic
1042875451 8:73436919-73436941 GGAATATTACAGGAAAAACATGG - Intronic
1043021390 8:75005224-75005246 GGGATACTACAAGCAATACAGGG + Intronic
1045407552 8:101881710-101881732 AGGCTTTAACAAATAAAACAAGG + Intronic
1046133782 8:109999774-109999796 GTGATTTTACAGAAAAAACAAGG - Intergenic
1046818685 8:118613426-118613448 GTTATATAACAAATAAAAAATGG - Intronic
1046847764 8:118937333-118937355 GGGGTTCCACAAATAAAACAAGG - Intronic
1047142800 8:122160936-122160958 GGAATATCACAAATAAAATGGGG - Intergenic
1051130978 9:13860662-13860684 GGGATATAACAAACAGAAAACGG - Intergenic
1051211476 9:14749338-14749360 AGGATATTATAAAGAAAAGAGGG + Intronic
1051877440 9:21806861-21806883 GGGAGATTAAAAATAAGACTTGG + Intronic
1052306693 9:27018216-27018238 TGGATATTCCAAATATTACATGG + Intronic
1052617496 9:30860393-30860415 AGAATAATACAAAGAAAACATGG + Intergenic
1052636307 9:31109740-31109762 AGGATATTAAAGATAAAAAATGG - Intergenic
1052675135 9:31612309-31612331 GGGATATTAGAAATAGAAATTGG - Intergenic
1052860324 9:33434226-33434248 GCGATATTCCAAACAAGACACGG - Intergenic
1055056108 9:72025609-72025631 GGACTATTATAAAGAAAACAAGG - Intergenic
1057287490 9:93771125-93771147 GCAATATTAGAAATAAAAGAGGG + Intergenic
1058177244 9:101750757-101750779 TGGATTTTACAAAGAAGACAAGG + Intergenic
1058253423 9:102730472-102730494 GAGAGATTACAAACAAAAGAGGG + Intergenic
1058656834 9:107230213-107230235 GGAAAAATAAAAATAAAACATGG + Intergenic
1059637251 9:116183107-116183129 GGCATAGTACAAAAAAAAAATGG - Intronic
1061787370 9:133038024-133038046 TGGCTATTTCAAATAGAACAGGG + Intronic
1186929105 X:14368953-14368975 GGGATATAACTAAAGAAACAAGG + Intergenic
1187489715 X:19739612-19739634 GGGGTATCACAGATAGAACAAGG + Intronic
1187582319 X:20621252-20621274 GAGATATTTAAAATTAAACAGGG - Intergenic
1188422932 X:30011336-30011358 GAGCTATTAAAAATAAAACAAGG - Intergenic
1189769402 X:44408614-44408636 GGGAAATTTAAAATAACACATGG + Intergenic
1190145214 X:47884850-47884872 GGGATATAAACAATAAAAAATGG + Intronic
1191957860 X:66665641-66665663 TGGACATTATATATAAAACAAGG - Intergenic
1193837152 X:86357827-86357849 TGGATATGCCAAATAAAACATGG - Intronic
1193986145 X:88242892-88242914 GGGACAGAACAAATAAAAAATGG + Intergenic
1194694079 X:97023800-97023822 GGTAAATTGCAAAGAAAACACGG - Intronic
1196034833 X:111132824-111132846 GGGATACTACATATGAGACAAGG + Intronic
1196839286 X:119843830-119843852 GGTATTTTATAAAGAAAACACGG - Intronic
1196986030 X:121272557-121272579 GTGAAATAAGAAATAAAACAGGG - Intergenic
1197360399 X:125494972-125494994 GAGATTTTACTAATAAAAAATGG + Intergenic
1198730432 X:139722150-139722172 GGGATATGACAATTAATATATGG - Intergenic
1199138507 X:144282004-144282026 GGGATCTTAGAAACAAAACATGG - Intergenic
1199161759 X:144620464-144620486 GAGAAATTACAAATGAAACCAGG - Intergenic
1199532980 X:148870744-148870766 GGGCTATTAAAAATAACAAAAGG + Intronic
1200846621 Y:7837256-7837278 AGGACATCACAAAGAAAACACGG + Intergenic