ID: 1033965873

View in Genome Browser
Species Human (GRCh38)
Location 7:146974641-146974663
Sequence TAGTAAAAGCATATTGATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1033965872_1033965873 22 Left 1033965872 7:146974596-146974618 CCAAATTGGAAATTAGTAATCTT 0: 1
1: 0
2: 0
3: 24
4: 261
Right 1033965873 7:146974641-146974663 TAGTAAAAGCATATTGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1033965873 Original CRISPR TAGTAAAAGCATATTGATGT TGG Intronic
No off target data available for this crispr