ID: 1033965873 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:146974641-146974663 |
| Sequence | TAGTAAAAGCATATTGATGT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1033965872_1033965873 | 22 | Left | 1033965872 | 7:146974596-146974618 | CCAAATTGGAAATTAGTAATCTT | 0: 1 1: 0 2: 0 3: 24 4: 261 |
||
| Right | 1033965873 | 7:146974641-146974663 | TAGTAAAAGCATATTGATGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1033965873 | Original CRISPR | TAGTAAAAGCATATTGATGT TGG | Intronic | ||
| No off target data available for this crispr | |||||